ST3GAL4 (NM_001254758) Human Untagged Clone

CAT#: SC330332

ST3GAL4 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4), transcript variant 3



  "NM_001254758" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ST3GAL4 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGS23; gal-NAc6S; NANTA3; SAT3; SIAT4; SIAT4C; ST-4; ST3GalA.2; ST3GalIV; STZ
Vector pCMV6-Entry
Sequence Data
>SC330332 representing NM_001254758.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCAGCAAGTCCCGCTGGAAGCTCCTGGCCATGTTGGCTCTGGTCCTGGTCGTCATGGTGTGGTAT
TCCATCTCCCGGGAAGACAGGTACATCGAGCTTTTTTATTTTCCCATCCCAGAGAAGAAGGAGCCGTGC
CTCCAGGGTGAGGCAGAGAGCAAGGCCTCTAAGCTCTTTGGCAACTACTCCCGGGATCAGCCCATCTTC
CTGCGGCTTGAGGATTATTTCTGGGTCAAGACGCCATCTGCTTACGAGCTGCCCTATGGGACCAAGGGG
AGTGAGGATCTGCTCCTCCGGGTGCTAGCCATCACCAGCTCCTCCATCCCCAAGAACATCCAGAGCCTC
AGGTGCCGCCGCTGTGTGGTCGTGGGGAACGGGCACCGGCTGCGGAACAGCTCACTGGGAGATGCCATC
AACAAGTACGATGTGGTCATCAGATTGAACAATGCCCCAGTGGCTGGCTATGAGGGTGACGTGGGCTCC
AAGACCACCATGCGTCTCTTCTACCCTGAATCTGCCCACTTCGACCCCAAAGTAGAAAACAACCCAGAC
ACACTCCTCGTCCTGGTAGCTTTCAAGGCAATGGACTTCCACTGGATTGAGACCATCCTGAGTGATAAG
AAGCGGGTGCGAAAGGGTTTCTGGAAACAGCCTCCCCTCATCTGGGATGTCAATCCTAAACAGATTCGG
ATTCTCAACCCCTTCTTCATGGAGATTGCAGCTGACAAACTGCTGAGCCTGCCAATGCAACAGCCACGG
AAGATTAAGCAGAAGCCCACCACGGGCCTGTTGGCCATCACGCTGGCCCTCCACCTCTGTGACTTGGTG
CACATTGCCGGCTTTGGCTACCCAGACGCCTACAACAAGAAGCAGACCATTCACTACTATGAGCAGATC
ACGCTCAAGTCCATGGCGGGGTCAGGCCATAATGTCTCCCAAGAGGCCCTGGCCATTAAGCGGATGCTG
GAGATGGGAGCTATCAAGAACCTCACGTCCTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001254758
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001254758.1
RefSeq Size 1727 bp
RefSeq ORF 1002 bp
Locus ID 6484
UniProt ID Q11206
Protein Families Secreted Protein, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
MW 38 kDa
Gene Summary This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3), as well as variants 2 and 8, encodes isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...