NABP1 (NM_001254736) Human Untagged Clone

CAT#: SC330323

NABP1 (untagged) - Homo sapiens nucleic acid binding protein 1 (NABP1), transcript variant 2



  "NM_001254736" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NABP1 mouse monoclonal antibody,clone OTI6B10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OBFC2A; SOSS-B2; SSB2
Vector pCMV6-Entry
Sequence Data
>SC330323 representing NM_001254736.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGAAAGGATGTCTGACACTTTATACTGGAAGGGGTGGTGAACTTCAAAAAATTGGGGAATTTTGT
ATGGTTTATTCAGAAGTGCCAAATTTCAGTGAACCCAACCCAGATTATCGAGGACAGCAGAACAAAGGG
GCACAGAGTGAACAGAAGAATAATTCCATGAATAGTAATATGGGTACAGGTACATTTGGACCAGTGGGA
AATGGTGTTCACACTGGCCCTGAATCAAGGGAACACCAGTTTTCACATGCTGGCAGAAGCAATGGCCGG
GGACTTATAAATCCACAACTACAAGGAACAGCTAGTAATCAAACAGTGATGACCACAATAAGTAATGGC
AGGGACCCTCGGAGAGCCTTTAAAAGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001254736
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001254736.1
RefSeq Size 3465 bp
RefSeq ORF 375 bp
Locus ID 64859
UniProt ID Q96AH0
MW 13.6 kDa
Gene Summary Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...