CD153 (TNFSF8) (NM_001252290) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CD30L; CD30LG; CD153; TNLG3A
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330283 representing NM_001252290. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACCCAGGGCTGCAGCAAGCACTCAACGGAATGGCCCCTCCTGGAGACACAGCCATGCATGTGCCG GCGGGCTCCGTGGCCAGCCACCTGGGGACCACGAGCCGCAGCTATTTCTATTTGACCACAGCCACTCTG GCTCTGTGCCTTGTCTTCACGGTGGCCACTATTATGGTGTTGGTCGTTCAGAGGACGGACTCCATTCCC AACTCACCTGACAACGTCCCCCTCAAAGGAGGAAATTGCTCAGAAGACCTCTTATGTATCCTGAAAAGG GCTCCATTCAAGAAGTCATGGGCCTACCTCCAAGTGGCAAAGCATCTAAACAAAACCAAGTTGTCTTGG AACAAAGATGGCATTCTCCATGGAGTCAGATATCAGGATGGGAATCTGGTGATCCAATTCCCTGATTAC TGTGGCATGATCCTCCACCATTCACACTCTACCCTGGACTCTGGGAAGGGACACTGCTGCCTTGAAACT CTACAACCCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001252290
Insert Size	495 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001252290.1
RefSeq Size	1526 bp
RefSeq ORF	495 bp
Locus ID	944
Protein Families	Druggable Genome, Transmembrane
Protein Pathways	Cytokine-cytokine receptor interaction
MW	17.8 kDa
Gene Summary	The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) uses an alternate splice site in the coding region of the last exon and contains an alternate downstream exon compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.