UGT2A1 (NM_001252275) Human Untagged Clone

CAT#: SC330282

UGT2A1 (untagged) - Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus (UGT2A1), transcript variant 3



  "NM_001252275" in other vectors (2)

CNY 5,130.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UGT2A1 Antibody - middle region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UDPGT2A1
Vector pCMV6-Entry
Sequence Data
>SC330282 representing NM_001252275.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTAAACAACCTTCTGCTGTTCTCCCTTCAGATAAGTCTCATAGGAACCACTCTTGGTGGGAATGTT
TTGATTTGGCCAATGGAAGGTAGTCATTGGCTAAATGTTAAGATAATTATAGATGAGCTCATTAAAAAG
GAGCATAATGTGACTGTCCTAGTTGCCTCTGGTGCACTTTTCATCACACCAACCTCTAACCCATCTCTG
ACATTTGAAATATATAGGGTGCCCTTTGGCAAAGAAAGAATAGAAGGAGTAATTAAGGACTTCGTTTTG
ACATGGCTGGAAAATAGACCATCTCCTTCAACCATTTGGAGATTCTATCAGGAGATGGCCAAAGTAATC
AAGGACTTCCACATGGTGTCTCAGGAGATCTGTGATGGCGTTCTTAAAAACCAACAGCTGATGGCAAAG
CTAAAGAAAAGCAAGTTTGAAGTCCTGGTGTCTGATCCAGTATTTCCTTGTGGCGATATAGTAGCTTTA
AAACTTGGAATTCCATTTATGTACTCCTTGAGGTTTTCTCCAGCCTCAACAGTGGAAAAGCACTGTGGG
AAGGTACCATACCCTCCTTCCTATGTTCCTGCTGTTTTATCAGAACTCACCGACCAAATGTCTTTCACT
GACAGAATAAGAAATTTCATCTCCTACCACCTACAGGACTACATGTTTGAAACTCTTTGGAAATCATGG
GATTCATACTATAGTAAAGCTTTAGGTGGACTCTTACTCTGTTGCCCAGGCTGGAGTGCAGTGGCGGAT
CTTGGCTCACTGCAACCTCTGCTTCCCGGGTTCAAGCGATTCTCCCGCCTCAGCCTCCATTGTAGTTGG
GATTACAGGCTGCCAGCAGGAAGACCCACTACGTTATGTGAGACTATGGGGAAAGCTGAAATTTGGTTA
ATCCGAACATATTGGGATTTTGAATTTCCTCGTCCATACTTACCTAATTTTGAGTTTGTTGGAGGATTG
CACTGCAAACCTGCCAAACCTTTACCTAAGGTTTTATGGAGATACAAAGGAAAGAAACCAGCCACATTA
GGAAACAATACTCAGCTCTTTGATTGGATACCCCAGAATGATCTTCTTGGACATCCCAAAACCAAAGCT
TTTATCACTCATGGTGGAACTAATGGGATCTACGAAGCTATTTACCACGGAGTCCCTATGGTGGGAGTT
CCCATGTTTGCTGATCAGCCTGATAACATTGCTCACATGAAGGCCAAAGGAGCAGCTGTGGAAGTGAAC
CTAAACACAATGACAAGTGTGGATTTGCTTAGCGCTTTGAGAACAGTCATTAATGAACCTTCTTATAAA
GAGAATGCTATGAGGTTATCAAGAATTCACCATGATCAACCTGTAAAGCCCCTGGATCGAGCAGTCTTC
TGGATCGAGTTTGTCATGCGCCACAAAGGAGCCAAGCACCTTCGGGTTGCAGCCCATGACCTCACCTGG
TTCCAGTACCACTCTTTGGATGTAATTGGGTTCTTGCTGGTCTGTGTGACAACGGCTATATTTTTGGTC
ATACAATGTTGTTTGTTTTCCTGTCAAAAATTTGGTAAGATAGGAAAGAAGAAAAAAAGAGAATAG

Restriction Sites SgfI-MluI     
ACCN NM_001252275
Insert Size 1584 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252275.1
RefSeq Size 2656 bp
RefSeq ORF 1584 bp
Locus ID 10941
UniProt ID Q9Y4X1
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
MW 60 kDa
Gene Summary The protein encoded by this gene belongs to the UDP-glycosyltransferase family, members of which catalyze biotransformation reactions in which lipophilic substrates are conjugated with glucuronic acid to increase water solubility and enhance excretion. They are of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This enzyme is expressed in the olfactory neuroepithelium, which lines the posterior nasal cavity and is exposed to a wide range of odorants and airborne toxic compounds. Hence, this protein has been suggested to be involved in clearing lipophilic odorant molecules from the sensory epithelium. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. This gene shares exon structure with the UDP glucuronosyltransferase 2A2 family member, which encodes N-terminally distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks an alternate in-frame exon but instead contains a different in-frame exon in the central coding region, compared to variant 2. The encoded isoform (3) is shorter than isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...