USP15 (NM_001252079) Human Untagged Clone

CAT#: SC330269

USP15 (untagged) - Homo sapiens ubiquitin specific peptidase 15 (USP15), transcript variant 3



  "NM_001252079" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to USP15 (ubiquitin specific peptidase 15)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms UNPH-2; UNPH4
Vector pCMV6-Entry
Sequence Data
>SC330269 representing NM_001252079.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAAGGCGGAGCGGCGGATCTGGACACCCAGCGGTCTGACATCGCGACGCTGCTCAAAACCTCG
CTCCGGAAAGGGGACACCTGGTACCTAGTCGATAGTCGCTGGTTCAAACAGTGGAAAAAATATGTTGGC
TTTGACAGTTGGGACAAATACCAGATGGGAGATCAAAATGTGTATCCTGGACCCATTGATAACTCTGGA
CTTCTCAAAGATGGTGATGCCCAGTCACTTAAGGAACACCTTATTGATGAATTGGATTACATACTGTTG
CCAACTGAAGGTTGGAATAAACTTGTCAGCTGGTACACATTGATGGAAGGTCAAGAGCCAATAGCACGA
AAGGTGGTTGAACAGGGTATGTTTGTAAAGCACTGCAAAGTAGAAGTATATCTCACAGAATTGAAGCTA
TGTGAAAATGGAAACATGAATAATGTTGTAACTCGAAGATTTAGCAAAGCTGACACAATAGATACAATT
GAAAAGGAAATAAGAAAAATCTTCAGTATTCCAGATGAAAAGGAGACCAGATTGTGGAACAAATACATG
AGTAACACATTTGAACCACTGAATAAACCAGACAGCACCATTCAGGATGCTGGTTTATACCAAGGACAG
GTATTAGTGATAGAACAGAAAAATGAAGATGGAACATGGCCAAGGGGTCCTTCTACTCCTAAAAAGCCA
CTAGAGCAGAGTTGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001252079
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252079.1
RefSeq Size 2286 bp
RefSeq ORF 708 bp
Locus ID 9958
UniProt ID Q9Y4E8
Protein Families Druggable Genome, Protease
MW 27.1 kDa
Gene Summary This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (3) differs in the 3' UTR and lacks a large portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...