RAB5C (NM_001252039) Human Untagged Clone

CAT#: SC330267

RAB5C (untagged) - Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 3



  "NM_001252039" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-RAB5C Rabbit Polyclonal Antibody
    • 100 ul

CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms L1880; RAB5CL; RAB5L; RABL
Vector pCMV6-Entry
Sequence Data
>SC330267 representing NM_001252039.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACTGAGTTGGAGGTCCCCCTCCCCACTAAGTGCCTCTTTGCATAGCACCAGTCCCCACCCGCAC
GCTCTCTGGACCACTACAGCTGGACGGGCAATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCA
GCTGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGC
CTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCTC
ACACAGACTGTCTGCCTGGATGACACAACAGTCAAGTTTGAGATCTGGGACACAGCTGGACAGGAGCGG
TATCACAGCCTGGCCCCCATGTACTATCGGGGGGCCCAGGCTGCCATCGTGGTCTATGACATCACCAAC
ACAGATACATTTGCACGGGCCAAGAACTGGGTGAAGGAGCTACAGAGGCAGGCCAGCCCCAACATCGTC
ATTGCACTCGCGGGTAACAAGGCAGACCTGGCCAGCAAGAGAGCCGTGGAATTCCAGGAAGCACAAGCC
TATGCAGACGACAACAGTTTGCTGTTCATGGAGACATCAGCAAAGACTGCAATGAACGTGAACGAAATC
TTCATGGCAATAGCTAAGAAGCTTCCCAAGAACGAGCCCCAGAATGCAACTGGTGCTCCAGGCCGAAAC
CGAGGTGTGGACCTCCAGGAGAACAACCCAGCCAGCCGGAGCCAGTGCTGCAGCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001252039
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252039.1
RefSeq Size 1918 bp
RefSeq ORF 750 bp
Locus ID 5878
UniProt ID P51148
Protein Families Druggable Genome
Protein Pathways Endocytosis
MW 27 kDa
Gene Summary Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment (Han et al., 1996 [PubMed 8646882]).[supplied by OMIM, Nov 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, contains an alternate exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) is longer and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...