p53 AIP1 (TP53AIP1) (NM_001251964) Human Untagged Clone
CAT#: SC330250
TP53AIP1 (untagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | P53AIP1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330250 representing NM_001251964.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGATCTTCCTCTGAGGCGAGCTTCAGATCTGCTCAAGCTTCCTGCAGTGGGGCCAGGAGGCAGGGC CTGGGCAGGGGAGACCAGAACCTCTCGGTGATGCCTCCGAATGGCAGGGCTCAGACACACACACCTGGC TGGGTAAGTCCCTGCAGTGAAAACCGAGACGGTCTTTTGCCTGCCACAGCCCCGGGCAGACTCTGCTCT CACCGTGGTGCCGACATCCCAAGTTTTCAGACTCACCAGGACCCAGTGACAGCATCTGGGTCCTCAGAG CTGCATGCGGACTGTCCCCAGTTCAGAGCATTGGACAGAGCTGGGAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001251964 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001251964.1 |
RefSeq Size | 3158 bp |
RefSeq ORF | 327 bp |
Locus ID | 63970 |
UniProt ID | Q9HCN2 |
Protein Families | Druggable Genome |
Protein Pathways | p53 signaling pathway |
MW | 11.3 kDa |
Gene Summary | This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4, also known as gamma) differs at the 3' end compared to variant 1, and encodes a shorter isoform (d) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231654 | TP53AIP1 (Myc-DDK tagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4 |
CNY 3,990.00 |
|
RG231654 | TP53AIP1 (tGFP-tagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4 |
CNY 2,920.00 |
其它p53 AIP1产品