TXN (NM_001244938) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	TRDX; TRX; TRX1; Trx80
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330231 representing NM_001244938. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTGAAGCAGATCGAGAGCAAGACTGCTTTTCAGGAAGCCTTGGACGCTGCAGGTGATAAACTTGTA GTAGTTGACTTCTCAGCCACGTGGTGTGGGCCTTGCAAAATGATCAAGCCTTTCTTTCATGATGTTGCT TCAGAGTGTGAAGTCAAATGCATGCCAACATTCCAGTTTTTTAAGAAGGGACAAAAGGTGGGTGAATTT TCTGGAGCCAATAAGGAAAAGCTTGAAGCCACCATTAATGAATTAGTCTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001244938
Insert Size	258 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001244938.1
RefSeq Size	826 bp
RefSeq ORF	258 bp
Locus ID	7295
UniProt ID	P10599
Protein Families	Druggable Genome
MW	9.5 kDa
Gene Summary	The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.