CD64 (FCGR1B) (NM_001244910) Human Untagged Clone

CAT#: SC330230

FCGR1B (untagged) - Homo sapiens Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 3



  "NM_001244910" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
FCGR1B Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD64b; FCG1; FcgammaRIa; FCGR1; FCGR1A; FcRI; IGFR1; IGFRB
Vector pCMV6-Entry
Sequence Data
>SC330230 representing NM_001244910.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGTTCTTGACAACTCTGCTCCTTTGGGTTCCAGTTGATGGGCAAGTGGACACCACAAAGGCAGTG
ATCACTTTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACCGTAACCTTGCACTGTGAGGTGCTC
CATCTGCCTGGGAGCAGCTCCACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACCCCCAGC
TACAGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTCAGGGCGA
AGTGACCCCATACAGCTGGAAATCCACAGAGGCTGGCTACTACTGCAGGTCTCCAGCAGAGTCTTCATG
GAAGGAGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAAGCTGGTGTACAATGTGCTTTACTAT
CGAAATGGCAAAGCCTTTAAGTTTTTCCACTGGAATTCTAACCTCACCATTCTGAAAACCAACATAAGT
CACAATGGCACCTACCATTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAATATCACAATAC
ACTGTGAAAGAGCTATTTCCAGCTCCAGTGCTGAATGCATCTGTGACATCCCCACTCCTGGAGGGGAAT
CTGGTCACCCTGAGCTGTGAAACAAAGTTGCTCTTGCAGAGGCCTGGTTTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001244910
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244910.1
RefSeq Size 1581 bp
RefSeq ORF 675 bp
Locus ID 2210
UniProt ID Q92637
Protein Families Transmembrane
MW 25.2 kDa
Gene Summary Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene likely encodes a non-functional protein that is not detectable at the cell surface and binds ligand with low affinity. [provided by RefSeq, Nov 2019]
Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a shorter isoform (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...