THNSL2 (NM_001244676) Human Untagged Clone

CAT#: SC330218

THNSL2 (untagged) - Homo sapiens threonine synthase-like 2 (S. cerevisiae) (THNSL2), transcript variant 2



  "NM_001244676" in other vectors (2)

CNY 3,900.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-THNSL2 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SOFAT; THS2; TSH2
Vector pCMV6-Entry
Sequence Data
>SC330218 representing NM_001244676.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGTATGTCAGCACCAGGGGCGTAGCCCCACGGGTCAACTTTGAGGGGGCCCTCTTCTCTGGCTAT
GCACCTGACGGGGGCCTCTTTATGCCTGAAGAGCTCCCACAGTTGGACAGAGGGACCCTGTGCCAGTGG
AGCACACTCTCCTATCCTGGCCTGGTGAAGGAGCTGTGTGCCCTCTTCATTGGCTCTGAGCTCCTTCCA
AAAGATGAATTAAATGATCTGATCGACCGAGCCTTCAGCAGATTCCGTCACAGAGAAGTGGTCCATCTG
TCCAGGTTGAGGAATGGGCTGAACGTGTTGGAGCTGTGGCATGGCGTCACATATGCATTTAAGGACCTG
TCCCTGTCCTGCACAACACAGTTCCTGCAGTACTTCCTGGAGAAGAGGGAGAAGCACGTCACTGTGGTT
GTAGGAACATCTGGGGACACAGGAAGTGCTGCCATTGAGAGTGTTCAAGGGGCAAAGAACATGGACATT
ATCGTTCTGCTGCCCAAAGGTCACTGCACAAAGATTCAGGAGCTCCAGATGACAACGGTGCTGAAGCAG
AACGTACATGTGTTTGGAGTGGAGGGAAACAGCGATGAGCTCGATGAGCCGATCAAGACTGTGTTTGCC
GATGTGGCTTTTGTCAAGAAGCACAATCTGATGAGCCTGAATTCGATCAACTGGTCCCGGGTCCTGGTG
CAGATGGCCCATCACTTCTTTGCTTACTTCCAGTGTACGCCATCCTTGGACACACATCCCCTACCCCTG
GTGGAGGTGGTTGTGCCAACAGGGGCTGCCGGTAACCTTGCAGCTGGGTACATTGCTCAAAAGATAGGC
CTGCCCATCCGTCTGGTCGTGGCAGTGAACCGCAATGACATCATCCACAGGACTGTCCAGCAGGGAGAC
TTCTCTCTCTCTGAGGCTGTTAAATCAACCTTGGCATCAGCTATGGACATTCAGGTGCCCTACAACATG
GAGAGGGTGTTCTGGCTGCTCTCTGGCTCTGACAGCCAGGTGACAAGAGCCCTCATGGAGCAGTTTGAA
AGGACCCAAAGTGTGAATCTGCCCAAGGAACTGCACAGCAAGTGGGAGAGACAGGACTACGAAAAAATG
GCTGTAATGGAGTGTGATGGGTGCTGTGTGGAACTGTGCCTTGGAAACTGTGGGCCCAGAAGAGGGAGC
GTGACAGATATCCCAGGGACAGCCATGGTCAGAGGTGGTGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244676
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244676.1
RefSeq Size 2169 bp
RefSeq ORF 1218 bp
Locus ID 55258
UniProt ID Q86YJ6
MW 45 kDa
Gene Summary This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) has a longer 5' UTR and uses an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...