APE1 (APEX1) (NM_001244249) Human Untagged Clone
CAT#: SC330209
APEX1 (untagged) - Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 4
CNY 3,140.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APE; APE1; APEN; APEX; APX; HAP1; REF1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330209 representing NM_001244249.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCC AAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAG GACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTG GATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTG TGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCT CATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGC CCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAA TTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTAC CGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTG TGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCT GGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTT AGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAG AATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAG ATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244249 |
Insert Size | 957 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001244249.1 |
RefSeq Size | 1558 bp |
RefSeq ORF | 957 bp |
Locus ID | 328 |
UniProt ID | P27695 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Base excision repair |
MW | 35.6 kDa |
Gene Summary | The APEX gene encodes the major AP endonuclease in human cells. It encodes the APEX endonuclease, a DNA repair enzyme with apurinic/apyrimidinic (AP) activity. Such AP activity sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. The AP sites are the most frequent pre-mutagenic lesions that can prevent normal DNA replication. Splice variants have been found for this gene; all encode the same protein. Disruptions in the biological functions related to APEX are associated with many various malignancies and neurodegenerative diseases.[provided by RefSeq, Dec 2019] Transcript Variant: This variant (4) uses a donor splice site for exon 1 downstream of that used by variant 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232466 | APEX1 (Myc-DDK tagged) - Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 4 |
CNY 2,400.00 |
|
RG232466 | APEX1 (tGFP-tagged) - Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 4 |
CNY 4,370.00 |