PRPSAP2 (NM_001243941) Human Untagged Clone

CAT#: SC330195

PRPSAP2 (untagged) - Homo sapiens phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), transcript variant 4



  "NM_001243941" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PRPSAP2 mouse monoclonal antibody, clone OTI1E3 (formerly 1E3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAP41
Vector pCMV6-Entry
Sequence Data
>SC330195 representing NM_001243941.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCTCCTGATCATGGTGTATGCATGTAAGACCTCTTGTGCCAAGAGCATCATTGGCGTGATACCC
TACTTTCCTTACAGCAAGCAGTGCAAGATGAGAAAAAGAGGCTCCATTGTCTCTAAATTGCTGGCTTCC
ATGATGTGCAAAGCTGGTCTAACTCATCTTATTACTATGGATTTACACCAGAAGGAAATTCAGGGCTTC
TTCAATATTCCTGTTGACAATTTAAGAGCATCTCCCTTCTTATTACAGTATATTCAAGAAGAGATCCCA
GATTACAGGAATGCAGTAATCGTGGCCAAGTCTCCAGCCTCGGCGAAGAGGGCACAGTCTTTTGCTGAG
CGCCTGCGCCTGGGAATTGCAGTGATTCATGGAGAGGCGCAGGATGCCGAGTCGGACTTGGTGGATGGA
CGGCATTCCCCACCCATGGTCAGAAGTGTGGCTGCCATCCACCCCAGCCTGGAGATCCCCATGCTGATT
CCTAAAGAAAAGCCCCCAATCACGGTTGTGGGTGATGTTGGAGGAAGGATTGCCATCATCGTGGATGAC
ATCATTGATGATGTTGACAGCTTTCTTGCTGCAGCAGAGACCCTGAAGGAAAGAGGTGCATATAAGATC
TTTGTGATGGCAACTCATGGCTTGTTGTCTTCTGACGCCCCCCGGCGGATTGAAGAGTCTGCCATTGAT
GAGGTGGTGGTCACCAATACAATTCCACATGAAGTCCAGAAGCTCCAGTGCCCCAAGATTAAAACTGTG
GATATCAGCATGATCCTTTCAGAGGCGATCCGTCGGATCCACAATGGGGAGTCCATGTCCTACCTTTTC
AGAAACATAGGCTTAGATGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243941
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243941.1
RefSeq Size 1872 bp
RefSeq ORF 852 bp
Locus ID 5636
UniProt ID O60256
Protein Families Druggable Genome
MW 31.3 kDa
Gene Summary This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks an in-frame exon in the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 4 and 5 encode the same isoform (4), which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...