PAMM (FAM213A) (NM_001243781) Human Untagged Clone
CAT#: SC330185
FAM213A (untagged) - Homo sapiens family with sequence similarity 213, member A (FAM213A), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Adrx; C10orf58; FAM213A; PAMM |
Vector | pCMV6-Entry |
Sequence Data |
>SC330185 representing NM_001243781.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACA GACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTG GAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTG CGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGAC CAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCT TATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATG TTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGA AACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTT CTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATG ATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243781 |
Insert Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243781.1 |
RefSeq Size | 1756 bp |
RefSeq ORF | 657 bp |
Locus ID | 84293 |
UniProt ID | Q9BRX8 |
Protein Families | Secreted Protein, Transmembrane |
MW | 24.5 kDa |
Gene Summary | Involved in redox regulation of the cell (PubMed:26438880, PubMed:19951071). Acts as an antioxidant (PubMed:19951071, PubMed:26438880). Inhibits TNFSF11-induced NFKB1 and JUN activation and osteoclast differentiation (PubMed:19951071). May affect bone resorption and help to maintain bone mass (PubMed:19951071). Acts as a negative regulator of macrophage-mediated inflammation by inhibiting macrophage production of inflammatory cytokines, probably through suppression of the MAPK signaling pathway (PubMed:26438880).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) uses an alternate splice site and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232173 | FAM213A (Myc-DDK tagged) - Homo sapiens family with sequence similarity 213, member A (FAM213A), transcript variant 5 |
CNY 3,990.00 |
|
RG232173 | FAM213A (tGFP-tagged) - Homo sapiens family with sequence similarity 213, member A (FAM213A), transcript variant 5 |
CNY 4,370.00 |