RAB6A (NM_001243719) Human Untagged Clone

CAT#: SC330164

RAB6A (untagged) - Homo sapiens RAB6A, member RAS oncogene family (RAB6A), transcript variant 3



  "NM_001243719" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to RAB6A (RAB6A, member RAS oncogene family)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAB6
Vector pCMV6-Entry
Sequence Data
>SC330164 representing NM_001243719.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTATGACAGTTTTGACAACACCTATCAGGCAACAATTGGCATTGACTTTTTATCAAAAACTATGTAC
TTGGAGGATCGAACAATCAGGCTTCAGCTGTGGGATACTGCGGGTCAGGAACGTTTCCGTAGCCTCATT
CCCAGTTACATCCGTGATTCTGCTGCAGCTGTAGTAGTTTACGATATCACAAATGTTAACTCATTCCAG
CAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGA
AATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTG
AATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCA
GCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAA
AAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243719
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243719.1
RefSeq Size 2863 bp
RefSeq ORF 528 bp
Locus ID 5870
UniProt ID P20340
Protein Families Druggable Genome
MW 19.9 kDa
Gene Summary This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) has an alternate 5' exon, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...