LIM domain only 3 (LMO3) (NM_001243611) Human Untagged Clone

CAT#: SC330152

LMO3 (untagged) - Homo sapiens LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 5



  "NM_001243611" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


LMO3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RBTN3; RBTNL2; Rhom-3; RHOM3
Vector pCMV6-Entry
Sequence Data
>SC330152 representing NM_001243611.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGAAAAAGGAGAAAAGTTTTGGTATACAAATGCTCTCAGTCCAGCCAGACACCAAGCCGAAAGGT
TGTGCTGGCTGCAACCGAAAGATCAAGGACCGGTATCTTCTAAAGGCACTGGACAAATACTGGCATGAA
GACTGCCTGAAGTGTGCCTGCTGTGACTGTCGCTTGGGAGAGGTGGGCTCCACCCTGTACACTAAAGCT
AATCTTATCCTTTGTCGCAGAGACTATCTGAGGCTCTTTGGTGTAACGGGAAACTGCGCTGCCTGTAGT
AAGCTCATCCCTGCCTTTGAGATGGTGATGCGTGCCAAGGACAATGTTTACCACCTGGACTGCTTTGCA
TGTCAGCTTTGTAATCAGAGATTTTGTGTTGGAGACAAATTTTTCCTAAAGAATAACATGATCCTTTGC
CAGACGGACTACGAGGAAGGTTTAATGAAAGAAGGTTATGCACCCCAGGTTCGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243611
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243611.1
RefSeq Size 3828 bp
RefSeq ORF 471 bp
Locus ID 55885
UniProt ID Q8TAP4
Protein Families Transcription Factors
MW 17.9 kDa
Gene Summary The protein encoded by this gene belongs to the rhombotin family of cysteine-rich LIM domain oncogenes. This gene is predominantly expressed in the brain. Related family members, LMO1 and LMO2 on chromosome 11, have been reported to be involved in chromosomal translocations in T-cell leukemia. Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (5) contains an alternate 5' terminal exon compared to variant 1. This results in translation initiation from an in-frame upstream start codon, and an isoform (2) with a longer N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...