SETDB1 (NM_001243491) Human Untagged Clone

CAT#: SC330127

SETDB1 (untagged) - Homo sapiens SET domain, bifurcated 1 (SETDB1), transcript variant 3



  "NM_001243491" in other vectors (2)

CNY 3,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SETDB1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ESET; H3-K9-HMTase4; KG1T; KMT1E; TDRD21
Vector pCMV6-Entry
Sequence Data
>SC330127 representing NM_001243491.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTCCCTTCCTGGGTGCATTGGTTTGGATGCAGCAACAGCTACAGTGGAGTCTGAAGAGATTGCA
GAGCTGCAACAGGCAGTGGTTGAGGAACTGGGTATCTCTATGGAGGAACTTCGGCATTTCATCGATGAG
GAACTGGAGAAGATGGATTGTGTACAGCAACGCAAGAAGCAGCTAGCAGAGTTAGAGACATGGGTAATA
CAGAAAGAATCTGAGGTGGCTCACGTTGACCAACTCTTTGATGATGCATCCAGGGCAGTGACTAATTGT
GAGTCTTTGGTGAAGGACTTCTACTCCAAGCTGGGACTACAATACCGGGACAGTAGCTCTGAGGACGAA
TCTTCCCGGCCTACAGAAATAATTGAGATTCCTGATGAAGATGATGATGTCCTCAGTATTGATTCAGGT
GATGCTGGGAGCAGAACTCCAAAAGACCAGAAGCTCCGTGAAGCTATGGCTGCCTTAAGAAAGTCAGCT
CAAGATGTTCAGAAGTTCATGGATGCTGTCAACAAGAAGAGCAGTTCCCAGGATCTGCATAAAGGAACC
TTGAGTCAGATGTCTGGAGAACTAAGCAAAGATGGTGACCTGATAGTCAGCATGCGAATTCTGGGCAAG
AAGAGAACTAAGACTTGGCACAAAGGCACCCTTATTGCCATCCAGACAGTTGGGCCAGGGAAGAAATAC
AAGGTGAAATTTGACAACAAAGGAAAGAGTCTACTGTCGGGGAACCATATTGCCTATGATTACCACCCT
CCTGCTGACAAGCTGTATGTGGGCAGTCGGGTGGTCGCCAAATACAAAGATGGGAATCAGGTCTGGCTC
TATGCTGGCATTGTAGCTGAGACACCAAACGTCAAAAACAAGCTCAGGTTTCTCATTTTCTTTGATGAT
GGCTATGCTTCCTATGTCACACAGTCGGAACTGTATCCCATTTGCCGGCCACTGAAAAAGACTTGGGAG
GACATAGAAGACATCTCCTGCCGTGACTTCATAGAGGAGTATGTCACTGCCTACCCCAACCGCCCCATG
GTACTGCTCAAGAGTGGCCAGCTTATCAAGACTGAGTGGGAAGGCACGTGGTGGAAGTCCCGAGTTGAG
GAGGTGGATGGCAGCCTAGTCAGGATCCTCTTCCTGGTACTGTTCTTCTCTACAATTTTGGAGGCAGAG
GTTGGTGGGGGGGGAACTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243491
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243491.1
RefSeq Size 1507 bp
RefSeq ORF 1194 bp
Locus ID 9869
UniProt ID Q15047
Protein Families Druggable Genome
Protein Pathways Lysine degradation
MW 44.7 kDa
Gene Summary This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR, differs in the 3' UTR and lacks a large portion of the coding region, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus and lacks the histone methyltransferase and SET domains, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...