Glutaredoxin 2 (GLRX2) (NM_001243399) Human Untagged Clone

CAT#: SC330120

GLRX2 (untagged) - Homo sapiens glutaredoxin 2 (GLRX2), transcript variant 3



  "NM_001243399" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GLRX2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-133; GRX2
Vector pCMV6-Entry
Sequence Data
>SC330120 representing NM_001243399.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGAGCAATACATCATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATCCAAGAAACA
ATTTCTGATAATTGTGTGGTGATTTTCTCAAAAACATCCTGTTCTTACTGTACAATGGCAAAAAAGCTT
TTCCATGACATGAATGTTAACTATAAAGTGGTGGAACTGGACCTGCTTGAATATGGAAACCAGTTCCAA
GATGCTCTTTACAAAATGACTGGTGAAAGAACTGTTCCAAGAATATTTGTCAATGGTACTTTTATTGGA
GGTGCAACTGACACTCATAGGCTTCACAAAGAAGGAAAATTGCTCCCACTAGTTCATCAGTGTTATTTA
AAAAAAAGTAAGAGGAAAGAATTTCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243399
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243399.1
RefSeq Size 976 bp
RefSeq ORF 375 bp
Locus ID 51022
UniProt ID Q9NS18
Protein Families Transcription Factors
MW 14.1 kDa
Gene Summary The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3, also known as Grx2c) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...