IL18 (NM_001243211) Human Untagged Clone

CAT#: SC330096

IL18 (untagged) - Homo sapiens interleukin 18 (interferon-gamma-inducing factor) (IL18), transcript variant 2



  "NM_001243211" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-IL18 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IGIF; IL-1g; IL-18; IL1F4
Vector pCMV6-Entry
Sequence Data
>SC330096 representing NM_001243211.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTT
TACTTTATAGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAAT
TTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGAC
TGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATG
GCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTT
AAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTC
CCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAA
GAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACT
GTTCAAAACGAAGACTAG

Restriction Sites SgfI-MluI     
ACCN NM_001243211
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243211.1
RefSeq Size 1151 bp
RefSeq ORF 570 bp
Locus ID 3606
UniProt ID Q14116
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway
MW 21.9 kDa
Gene Summary The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020]
Transcript Variant: This variant (2, also known as Delta3pro-IL-18) lacks an in-frame coding exon compared to variant 1. The encoded isoform (2) is shorter and may be resistant to proteolytic activation, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...