INPP5F (NM_001243195) Human Untagged Clone

CAT#: SC330092

INPP5F (untagged) - Homo sapiens inositol polyphosphate-5-phosphatase F (INPP5F), transcript variant 3



  "NM_001243195" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
INPP5F mouse monoclonal antibody,clone OTI1D4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hSAC2; MSTP007; MSTPO47; SAC2
Vector pCMV6-Entry
Sequence Data
>SC330092 representing NM_001243195.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCTCTTCCAAGCCAAGGACCACTACATCCTGCAGCAGGGCGAGCGCGCGCTGTGGTGCAGCCGC
CGCGACGGCGGCCTCCAGCTCCGACCCGCTACTGATCTACTTCTTGCCTGGAATCCCATTTGTTTGGGG
TTGGTAGAAGGTGTTATTGGGAAAATTCAACTTCATTCAGATCTTCCATGGTGGCTTATTCTAATTCGG
CAGAAAGCATTGGTGGGCAAACTCCCAGGAGACCATGAGGTCTGTAAAGTTACCAAAATTGCTGTGCTC
TCACTTTCTGAAATGGAACCTCAGGATCTTGAGCTAGAGCTCTGTAAGAAGCATCATTTTGGTATTAAC
AAACCAGAGAAGATCATACCATCTCCTGATGACTCAAAGTTTCTACTGAAGACCTTTACGCATATTAAA
TCCAATGTGTCTGCTCCTAATAAAAAGAAAGTTAAGGAAAGTAAAGAGAAGGAGAAGTTGGAGAGGAGA
TTACTTGAAGAGTTGCTGAAGATGTTCATGGACTCAGAATCCTTTTATTATAGCTTGACCTATGACCTG
ACCAATTCCGTGCAGAGGCAGAGCACTGGGGAGAGGGACGGTCGGCCCCTCTGGCAGAAGGTACCACTC
ACAGCTCGTAGAGCAGGGTTTGCACTTGGGAAGAAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243195
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243195.1
RefSeq Size 1000 bp
RefSeq ORF 660 bp
Locus ID 22876
UniProt ID Q9Y2H2
Protein Families Druggable Genome
MW 25.2 kDa
Gene Summary The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...