RSPO1 (NM_001242909) Human Untagged Clone
CAT#: SC330057
RSPO1 (untagged) - Homo sapiens R-spondin 1 (RSPO1), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRISTIN3; RSPO |
Vector | pCMV6-Entry |
Sequence Data |
>SC330057 representing NM_001242909.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATATTCCGAGTCAGTGCCGAGGGGAGCCAGGCCTGTGCCAAAGGCTGTGAGCTCTGCTCTGAAGTC AACGGCTGCCTCAAGTGCTCACCCAAGCTGTTCATCCTGCTGGAGAGGAACGACATCCGCCAGGTGGGC GTCTGCTTGCCGTCCTGCCCACCTGGATACTTCGACGCCCGCAACCCCGACATGAACAAGTGCATCAAA TGCAAGATCGAGCACTGTGAGGCCTGCTTCAGCCATAACTTCTGCACCAAGTGTAAGGAGGGCTTGTAC CTGCACAAGGGCCGCTGCTATCCAGCTTGTCCCGAGGGCTCCTCAGCTGCCAATGGCACCATGGAGTGC AGTAGTCCTGCGCAATGTGAAATGAGCGAGTGGTCTCCGTGGGGGCCCTGCTCCAAGAAGCAGCAGCTC TGTGGTTTCCGGAGGGGCTCCGAGGAGCGGACACGCAGGGTGCTACATGCCCCTGTGGGGGACCATGCT GCCTGCTCTGACACCAAGGAGACCCGGAGGTGCACAGTGAGGAGAGTGCCGTGTCCTGAGGGGCAGAAG AGGAGGAAGGGAGGCCAGGGCCGGCGGGAGAATGCCAACAGGAACCTGGCCAGGAAGGAGAGCAAGGAG GCGGGTGCTGGCTCTCGAAGACGCAAGGGGCAGCAACAGCAGCAGCAGCAAGGGACAGTGGGGCCACTC ACATCTGCAGGGCCTGCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242909 |
Insert Size | 711 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242909.1 |
RefSeq Size | 2589 bp |
RefSeq ORF | 711 bp |
Locus ID | 284654 |
UniProt ID | Q2MKA7 |
Protein Families | Secreted Protein |
MW | 26 kDa |
Gene Summary | This gene encodes a secreted activator protein with two cysteine-rich, furin-like domains and one thrombospondin type 1 domain. The encoded protein is a ligand for leucine-rich repeat-containing G-protein coupled receptors (LGR proteins) and positively regulates the Wnt signaling pathway. In mice, the protein induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR and uses an alternate splice site in the 5' region and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232237 | RSPO1 (Myc-DDK tagged) - Homo sapiens R-spondin 1 (RSPO1), transcript variant 3 |
CNY 3,840.00 |
|
RC232237L3 | Lenti ORF clone of Human R-spondin 1 (RSPO1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RG232237 | RSPO1 (tGFP-tagged) - Homo sapiens R-spondin 1 (RSPO1), transcript variant 3 |
CNY 4,370.00 |