ARFIP2 (NM_001242855) Human Untagged Clone

CAT#: SC330028

ARFIP2 (untagged) - Homo sapiens ADP-ribosylation factor interacting protein 2 (ARFIP2), transcript variant 3



  "NM_001242855" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ARFIP2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms POR1
Vector pCMV6-Entry
Sequence Data
>SC330028 representing NM_001242855.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGTCAGGACCCAACCTCAATGAAACCAGCATTGTGTCTGGTGGCTATGGGGGCTCTGGTGATGGA
CTCATCCCCACAGGGTCTGGCCGCCATCCATCTCACAGCACCACTCCTTCTGGCCCTGGAGATGAGGTG
GCTCGGGGCATTGCTGGAGAAAAGTTTGACATCGTCAAGAAATGGGGCATCAACACCTATAAGTGCACA
AAGCAACTGTTATCAGAACGATTTGGTCGAGGCTCACGGACTGTGGACCTGGAGCTAGAGCTGCAGATT
GAGTTGCTGCGTGAGACGAAGCGCAAGTATGAGAGTGTCCTGCAGCTGGGCCGGGCACTGACAGCCCAC
CTCTACAGCCTGCTGCAGACCCAGCATGCACTGGGTGATGCCTTTGCTGACCTCAGCCAGAAGTCCCCA
GAGCTTCAGGAGGAATTTGGCTACAATGCAGAGACACAGAAACTACTATGCAAGAATGGGGAAACGCTG
CTAGGAGCCGTGAACTTCTTTGTCTCTAGCATCAACACATTGGTCACCAAGACCATGGAAGACACGCTC
ATGACTGTGAAACAGTATGAGGCTGCCAGGCTGGAATATGATGCCTACCGAACAGACTTAGAGGAGCTG
AGTCTAGGCCCCCGGGATGCAGGGACACGTGGTCGACTTGAGAGTGCCCAGGCCACTTTCCAGGCCCAT
CGGGACAAGTATGAGAAGCTGCGGGGAGATGTGGCCATCAAGCTCAAGTTCCTGGAAGAAAACAAGATC
AAGGTGATGCACAAGCAGCTGCTGCTCTTCCACAATGCTGTGTCCGCCTACTTTGCTGGGAACCAGAAA
CAGCTGGAGCAGACCCTGCAGCAGTTCAACATCAAGCTGCGGCCTCCAGGAGCTGAGAAACCCTCCTGG
CTAGAGGAGCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242855
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242855.1
RefSeq Size 3624 bp
RefSeq ORF 912 bp
Locus ID 23647
UniProt ID P53365
Protein Families Druggable Genome
MW 33.8 kDa
Gene Summary Putative target protein of ADP-ribosylation factor. Involved in membrane ruffling.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream in-frame start codon, and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus and lacks an internal segment, compared to isoform 1. Variants 3 and 7 both encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...