ELOVL5 (NM_001242831) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	dJ483K16.1; HELO1; SCA38
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330025 representing NM_001242831. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAACATTTTGATGCATCACTTAGTACCTATTTCAAGGCATTGCTAGGCCCTCGAGGTATCAGCAGC TCTGTCCTCAGAATGGGTCCCCCACTTCACACAGTTGTAGGATGGCTACAGCAGCTCCAAGCAGCACAT TCAGAGGAAGAAGAAAAAATGTTTCATTTGTGTGGTTTTAAGCATAAAGAAGTTGTTTCCCAGAGCTCT TTGCCAGCTGTCATCCCTCAAAACTCACTGGCCACAATTGCTTCACATGCCCCTGCCTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001242831
Insert Size	267 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001242831.1
RefSeq Size	849 bp
RefSeq ORF	267 bp
Locus ID	60481
UniProt ID	Q9NYP7
Protein Families	Transmembrane
Protein Pathways	Biosynthesis of unsaturated fatty acids
MW	9.6 kDa
Gene Summary	This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (4) lacks several 3' exons and contains a novel 3' terminal exon compared to variant 1. The resulting isoform (4) is shorter with a distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.