PTK9 (TWF1) (NM_001242397) Human Untagged Clone

CAT#: SC329948

TWF1 (untagged) - Homo sapiens twinfilin actin-binding protein 1 (TWF1), transcript variant 1



  "NM_001242397" in other vectors (2)

CNY 3,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TWF1 mouse monoclonal antibody,clone OTI5C12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A6; PTK9
Vector pCMV6-Entry
Sequence Data
>SC329948 representing NM_001242397.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCACCAGACCGGCATCCAAGCAAGTGAAGATGTTAAAGAGATCTTTGCCAGAGCCAGAAATGGA
AAGTACAGACTTCTGAAAATATCTATTGAAAATGAGCAACTTGTGATTGGATCATATAGTCAGCCTTCA
GATTCCTGGGATAAGGATTATGATTCCTTTGTTTTACCCCTGTTGGAGGACAAACAACCATGCTATATA
TTATTCAGGTTAGATTCTCAGAATGCCCAGGGATATGAATGGATATTCATTGCATGGTCTCCAGATCAT
TCTCATGTTCGTCAAAAAATGTTGTATGCAGCAACAAGAGCAACTCTGAAGAAGGAATTTGGAGGTGGC
CACATTAAAGATGAAGTATTTGGAACAGTAAAGGAAGATGTATCATTACATGGATATAAAAAATACTTG
CTGTCACAATCTTCCCCTGCCCCACTGACTGCAGCTGAGGAAGAACTACGACAGATTAAAATCAATGAG
AGCCCAGAGGATCATATTGGGGTACAGACTGACGTGGGTGTGGACACTAAGCATCAAACACTACAAGGA
GTAGCATTTCCCATTTCTCGAGAAGCCTTTCAGGCTTTGGAAAAATTGAATAATAGACAGCTCAACTAT
GTGCAGTTGGAAATAGATATAAAAAATGAAATTATAATTTTGGCCAACACAACAAATACAGAACTGAAA
GATTTGCCAAAGAGGATTCCCAAGGATTCAGCTCGTTACCATTTCTTTCTGTATAAACATTCCCATGAA
GGAGACTATTTAGAGTCCATAGTTTTTATTTATTCAATGCCTGGATACACATGCAGTATAAGAGAGCGG
ATGCTGTATTCTAGCTGCAAGAGCCGTCTGCTAGAAATTGTAGAAAGACAACTACAAATGGATGTAATT
AGAAAGATCGAGATAGACAATGGGGATGAGTTGACTGCAGACTTCCTTTATGAAGAAGTACATCCCAAG
CAGCATGCACACAAGCAAAGTTTTGCAAAACCAAAAGGTCCTGCAGGAAAAAGAGGAATTCGAAGACTA
ATTAGGGGCCCAGCGGAAACTGAAGCTACTACTGATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242397
Insert Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242397.1
RefSeq Size 3083 bp
RefSeq ORF 1074 bp
Locus ID 5756
UniProt ID Q12792
Protein Families Druggable Genome, Protein Kinase
MW 41 kDa
Gene Summary This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...