LHX6 (NM_001242333) Human Untagged Clone

CAT#: SC329926

LHX6 (untagged) - Homo sapiens LIM homeobox 6 (LHX6), transcript variant 3



  "NM_001242333" in other vectors (2)

CNY 3,520.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-LHX6 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LHX6.1
Vector pCMV6-Entry
Sequence Data
>SC329926 representing NM_001242333.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGCCGGGGGTTGTGCCGGCGCAGCGCTGAGAATCCCGACGCGGGGCCGGTGATGGCCCAGCCAGGG
TCCGGCTGCAAAGCGACCACCCGCTGTCTTGAAGGGACCGCGCCGCCCGCCATGGCTCAGTCTGACGCC
GAGGCCCTGGCAGGAGCTCTGGACAAGGACGAGGGTCAGGCCTCCCCATGTACGCCCAGCACGCCATCT
GTCTGCTCACCGCCCTCTGCCGCCTCCTCCGTGCCGTCTGCAGGCAAGAACATCTGCTCCAGCTGCGGC
CTCGAGATCCTGGACCGATATCTGCTCAAGGTCAACAACCTCATCTGGCACGTGCGGTGCCTCGAGTGC
TCCGTGTGTCGCACGTCGCTGAGGCAGCAGAACAGCTGCTACATCAAGAACAAGGAGATCTTCTGCAAG
ATGGACTACTTCAGCCGATTCGGGACCAAGTGTGCCCGGTGCGGCCGACAGATCTACGCCAGCGACTGG
GTGCGGAGAGCTCGCGGCAACGCCTACCACCTGGCCTGCTTCGCCTGCTTCTCGTGCAAGCGCCAGCTG
TCCACTGGTGAGGAGTTCGGCCTGGTCGAGGAGAAGGTGCTCTGCCGCATCCACTACGACACCATGATT
GAGAACCTCAAGAGGGCCGCCGAGAACGGGAACGGCCTCACGTTGGAGGGGGCAGTGCCCTCGGAACAG
GACAGTCAACCCAAGCCGGCCAAGCGCGCGCGGACGTCCTTCACCGCGGAACAGCTGCAGGTTATGCAG
GCGCAGTTCGCGCAGGACAACAACCCCGACGCTCAGACGCTGCAGAAGCTGGCGGACATGACGGGCCTC
AGCCGGAGAGTCATCCAGGTGTGGTTTCAAAACTGCCGGGCGCGTCATAAAAAGCACACGCCGCAACAC
CCAGTGCCGCCCTCGGGGGCGCCCCCGTCCCGCCTTCCCTCCGCCCTGTCCGACGACATCCACTACACC
CCGTTCAGCAGCCCCGAGCGGGCGCGCATGGTCACCCTGCACGGCTACATTGAGAGTCATCCTTTTTCA
GTACTAACGCTGCCGGCACTTCCGCATCTGCCCGTGGGCGCCCCACAGCTGCCCCTCAGCCGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242333
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242333.1
RefSeq Size 3306 bp
RefSeq ORF 1101 bp
Locus ID 26468
UniProt ID Q9UPM6
Protein Families Transcription Factors
MW 40.2 kDa
Gene Summary This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein has tandem LIM domains as well as a DNA-binding homeodomain. The protein functions as a transcription factor involved in embryogenesis and head development and is highly expressed in neural crest derived mesenchyme cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks a segment in the coding region, which leads to a frameshift, compared to variant 1. The resulting isoform (3) has shorter and distinct N- and C- termini compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...