Caveolin 2 (CAV2) (NM_001206748) Human Untagged Clone
CAT#: SC329837
CAV2 (untagged) - Homo sapiens caveolin 2 (CAV2), transcript variant 3
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAV |
Vector | pCMV6-Entry |
Sequence Data |
>SC329837 representing NM_001206748.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACC CTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTG CAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTC TCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206748 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206748.1 |
RefSeq Size | 3006 bp |
RefSeq ORF | 240 bp |
Locus ID | 858 |
UniProt ID | P51636 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Focal adhesion |
MW | 8.8 kDa |
Gene Summary | The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462). [provided by RefSeq, May 2011] Transcript Variant: This variant (3) differs at the 5' end compared to variant 1, and initiates translation from an in-frame downstream AUG, resulting in an isoform (d) with a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Caveolin 2产品
Customer
Reviews
Loading...