Caveolin 2 (CAV2) (NM_001206747) Human Untagged Clone

CAT#: SC329836

CAV2 (untagged) - Homo sapiens caveolin 2 (CAV2), transcript variant 1



  "NM_001206747" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal CAV2 Antibody (N-term)
    • 400 ul

CNY 6,314.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAV
Vector pCMV6-Entry
Sequence Data
>SC329836 representing NM_001206747.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCG
GACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAG
CCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATAC
GTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCC
ACCCTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCA
GTGCAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGC
TTCTCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206747
Insert Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206747.1
RefSeq Size 3121 bp
RefSeq ORF 450 bp
Locus ID 858
UniProt ID P51636
Protein Families Druggable Genome, Transmembrane
Protein Pathways Focal adhesion
MW 16.8 kDa
Gene Summary The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462). [provided by RefSeq, May 2011]
Transcript Variant: This variant (1) encodes two isoforms resulting from the use of alternate in-frame, translation initiation codons. This RefSeq represents the shorter isoform (b, also known as beta) derived from the use of the downstream AUG (at nt 221-223). Isoform beta has been shown to localize almost exclusively in lipid droplets (PMID:11238462).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...