HSD11B1 (NM_001206741) Human Untagged Clone

CAT#: SC329835

HSD11B1 (untagged) - Homo sapiens hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1), transcript variant 3



  "NM_001206741" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to HSD11B1 (hydroxysteroid (11-beta) dehydrogenase 1)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
Vector pCMV6-Entry
Sequence Data
>SC329835 representing NM_001206741.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTTTTATGAAAAAATATCTCCTCCCCATTCTGGGGCTCTTCATGGCCTACTACTACTATTCTGCA
AACGAGGAATTCAGACCAGAGATGCTCCAAGGAAAGAAAGTGATTGTCACAGGGGCCAGCAAAGGGATC
GGAAGAGAGATGGCTTATCATCTGGCGAAGATGGGAGCCCATGTGGTGGTGACAGCGAGGTCAAAAGAA
ACTCTACAGAAGGTGGTATCCCACTGCCTGGAGCTTGGAGCAGCCTCAGCACACTACATTGCTGGCACC
ATGGAAGACATGACCTTCGCAGAGCAATTTGTTGCCCAAGCAGGAAAGCTCATGGGAGGACTAGACATG
CTCATTCTCAACCACATCACCAACACTTCTTTGAATCTTTTTCATGATGATATTCACCATGTGCGCAAA
AGCATGGAAGTCAACTTCCTCAGTTACGTGGTCCTGACTGTAGCTGCCTTGCCCATGCTGAAGCAGAGC
AATGGAAGCATTGTTGTCGTCTCCTCTCTGGCTGGGAAAGTGGCTTATCCAATGGTTGCTGCCTATTCT
GCAAGCAAGTTTGCTTTGGATGGGTTCTTCTCCTCCATCAGAAAGGAATATTCAGTGTCCAGGGTCAAT
GTATCAATCACTCTCTGTGTTCTTGGCCTCATAGACACAGAAACAGCCATGAAGGCAGTTTCTGGGATA
GTCCATATGCAAGCAGCTCCAAAGGAGGAATGTGCCCTGGAGATCATCAAAGGGGGAGCTCTGCGCCAA
GAAGAAGTGTATTATGACAGCTCACTCTGGACCACTCTTCTGATCAGAAATCCATGCAGGAAGATCCTG
GAATTTCTCTACTCAACGAGCTATAATATGGACAGATTCATAAACAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206741
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001206741.1
RefSeq Size 1479 bp
RefSeq ORF 879 bp
Locus ID 3290
UniProt ID P28845
Protein Families Druggable Genome, Transmembrane
Protein Pathways Androgen and estrogen metabolism, C21-Steroid hormone metabolism, Metabolic pathways
MW 32.4 kDa
Gene Summary The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...