AMPK gamma 1 (PRKAG1) (NM_001206710) Human Untagged Clone
CAT#: SC329832
PRKAG1 (untagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AMPKG |
Vector | pCMV6-Entry |
Sequence Data |
>SC329832 representing NM_001206710.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGTCTCATCGCTGCTATGACCTGATTCCCACAAGCTCCAAATTGGTTGTATTTGATACGTCCCTG CAGGTGAAGAAAGCTTTTTTTGCTTTGGTGACTAACGGTGTACGAGCTGCCCCTTTATGGGATAGTAAG AAGCAAAGTTTTGTGGGCATGCTGACCATCACTGATTTCATCAATATCCTGCACCGCTACTATAAATCA GCCTTGGTACAGATCTATGAGCTAGAAGAACACAAGATAGAAACTTGGAGAGAGGTGTATCTCCAGGAC TCCTTTAAACCGCTTGTCTGCATTTCTCCTAATGCCAGCTTGTTTGATGCTGTCTCTTCATTAATTCGG AACAAGATCCACAGGCTGCCAGTTATTGACCCAGAATCAGGCAATACTTTGTACATCCTCACCCACAAG CGCATTCTGAAGTTCCTCAAATTGTTTATCACTGAGTTCCCCAAGCCAGAGTTCATGTCCAAGTCTCTG GAAGAGCTACAGATTGGCACCTATGCCAATATTGCTATGGTTCGCACTACCACCCCCGTCTATGTGGCT CTGGGGATTTTTGTACAGCATCGAGTCTCAGCCCTGCCAGTGGTGGATGAGAAGGGGCGTGTGGTGGAC ATCTACTCCAAGTTTGATGTTATCAATCTGGCAGCAGAAAAGACCTACAACAACCTAGATGTATCTGTG ACTAAAGCCTTGCAACATCGATCACATTACTTTGAGGGTGTTCTCAAGTGCTACCTGCATGAGACTCTG GAGACCATCATCAACAGGCTAGTGGAAGCAGAGGTTCACCGACTTGTAGTGGTGGATGAAAATGATGTG GTCAAGGGAATTGTATCACTGTCTGACATCCTGCAGGCCCTGGTGCTCACAGGTGGAGAGAAGAAGCCC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206710 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001206710.1 |
RefSeq Size | 1854 bp |
RefSeq ORF | 900 bp |
Locus ID | 5571 |
UniProt ID | P54619 |
Protein Families | Druggable Genome |
Protein Pathways | Adipocytokine signaling pathway, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway |
MW | 34.1 kDa |
Gene Summary | The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232409 | PRKAG1 (Myc-DDK tagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4 |
CNY 3,990.00 |
|
RG232409 | PRKAG1 (tGFP-tagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4 |
CNY 4,370.00 |
其它AMPK gamma 1产品