POLR1D (NM_001206559) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	AC19; POLR1C; RPA9; RPA16; RPAC2; RPC16; RPO1-3; TCS2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329817 representing NM_001206559. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGACCCATGGGTTGGATGAAGTGTCCTCTTGCTAGCACCAATAAAAGATTTCTAATTAACACAATT AAAAACACATTGCCCTCTCATAAAGAGCAAGACCATGAACAAAAAGAGGGCGATAAGGAACCAGCGAAG AGCCAGGCCCAGAAAGAAGAAAACCCGAAGAAACACAGAAGCCATCCTTACAAGCACAGCTTCCGCGCT CGAGGTTCCGCCAGTTACTCCCCGCCACGAAAGCGGAGCAGCCAGGACAAGTACGAAAAGCGGTCCAAC CGGCGGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001206559
Insert Size	285 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001206559.1
RefSeq Size	2210 bp
RefSeq ORF	285 bp
Locus ID	51082
UniProt ID	P0DPB5
Protein Families	Stem cell - Pluripotency, Transcription Factors
Protein Pathways	Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
MW	11 kDa
Gene Summary	The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011] Transcript Variant: This variant (3) differs in both UTRs and in the coding region, compared to variant 1. The encoded isoform (3) shares identity with isoform 2 but is distinct and shorter, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.