MAGEA5 (MAGEA10-MAGEA5) (NM_001204811) Human Untagged Clone

CAT#: SC329765

MAGEA10 (untagged) - Homo sapiens MAGEA10-MAGEA5 readthrough (MAGEA10-MAGEA5)



  "NM_001204811" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MAGEA5 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT1.5
Vector pCMV6-Entry
Sequence Data
>SC329765 representing NM_001204811.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTCTTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGACACCCAAGAAGAGGCCCTG
GGCCTGGTGGGTGTGCAGGCTGCCACTACTGAGGAGCAGGAGGCTGTGTCCTCCTCCTCTCCTCTGGTC
CCAGGCACCCTGGGGGAGGTGCCTGCTGCTGGGTCACCAGGTCCTCTCAAGAGTCCTCAGGGAGCCTCC
GCCATCCCCACTGCCATCGATTTCACTCTATGGAGGCAATCCATTAAGGGCTCCAGCAACCAAGAAGAG
GAGGGGCCAAGCACCTCCCCTGACCCAGAGTCTGTGTTCCGAGCAGCACTCAGTAAGAAGGTGGCTGAC
TTGATTCATTTTCTGCTCCTCAAGTATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204811
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204811.2
RefSeq Size 1873 bp
RefSeq ORF 375 bp
Locus ID 100533997
UniProt ID P43359
MW 13 kDa
Gene Summary This locus represents naturally occurring read-through transcription between the neighboring MAGEA10 (melanoma antigen family A, 10) and MAGEA5 (melanoma antigen family A, 5) genes on chromosome X. The read-through transcript is predicted to encode the downstream gene product. [provided by RefSeq, Mar 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...