Signal sequence receptor delta (SSR4) (NM_001204526) Human Untagged Clone

CAT#: SC329762

SSR4 (untagged) - Homo sapiens signal sequence receptor, delta (SSR4), transcript variant 1



  "NM_001204526" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SSR4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDG1Y; TRAPD
Vector pCMV6-Entry
Sequence Data
>SC329762 representing NM_001204526.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCGGCCCAGCCGTTCGGCAGAGAAGAGGCGATGGCGGCGATGGCATCTCTCGGCGCCCTGGCGCTG
CTCCTGCTGTCCAGCCTCTCCCGCTGCTCAGCCGAGGCCTGCCTGGAGCCCCAGATCACCCCTTCCTAC
TACACCACTTCTGACGCTGTCATTTCCACTGAGACCGTCTTCATTGTGGAGATCTCCCTGACATGCAAG
AACAGGGTCCAGAACATGGCTCTCTATGCTGACGTCGGTGGAAAACAATTCCCTGTCACTCGAGGCCAG
GATGTGGGGCGTTATCAGGTGTCCTGGAGCCTGGACCACAAGAGCGCCCACGCAGGCACCTATGAGGTT
AGATTCTTCGACGAGGAGTCCTACAGCCTCCTCAGGAAGGCTCAGAGGAATAACGAGGACATTTCCATC
ATCCCGCCTCTGTTTACAGTCAGCGTGGACCATCGGGGCACTTGGAACGGGCCCTGGGTGTCCACTGAG
GTGCTGGCTGCGGCGATCGGCCTTGTGATCTACTACTTGGCCTTCAGTGCGAAGAGCCACATCCAGGCC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001204526
Insert Size 555 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204526.1
RefSeq Size 754 bp
RefSeq ORF 555 bp
Locus ID 6748
UniProt ID P51571
Protein Families Druggable Genome
MW 20.2 kDa
Gene Summary This gene encodes the delta subunit of the translocon-associated protein complex which is involved in translocating proteins across the endoplasmic reticulum membrane. The encoded protein is located in the Xq28 region and is arranged in a compact head-to-head manner with the isocitrate dehydrogenase 3 (NAD+) gamma gene and both genes are driven by a CpG-embedded bidirectional promoter. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Signal sequence receptor delta产品

Customer Reviews 
Loading...