MGST2 (NM_001204368) Human Untagged Clone
CAT#: SC329741
MGST2 (untagged) - Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant 4
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GST2; MGST-II |
Vector | pCMV6-Entry |
Sequence Data |
>SC329741 representing NM_001204368.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGGGAACTCGATCCTGCTGGCTGCTGTCTCTATTCTCTCGGCCTGTCAGCAAAGTTATTTTGCT TTGCAAGTTGGAAAGGCAAGATTAAAATACAAAGTTACGCCCCCAGCAGTCACTGGGTCACCAGAGTTT GAGAGAGTATTTCGGGCACATTTTTGCTACTTGTCTGGGTCTGGTGTACATATATGGCCGTCACCTATA CTTCTGGGGATATTCAGAAGCTGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204368 |
Insert Size | 234 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204368.1 |
RefSeq Size | 746 bp |
RefSeq ORF | 234 bp |
Locus ID | 4258 |
UniProt ID | Q99735 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
MW | 8.4 kDa |
Gene Summary | The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (4) lacks an exon in the 3' region, which results in frame-shift, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...