MGST2 (NM_001204368) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	GST2; MGST-II
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329741 representing NM_001204368. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGGGAACTCGATCCTGCTGGCTGCTGTCTCTATTCTCTCGGCCTGTCAGCAAAGTTATTTTGCT TTGCAAGTTGGAAAGGCAAGATTAAAATACAAAGTTACGCCCCCAGCAGTCACTGGGTCACCAGAGTTT GAGAGAGTATTTCGGGCACATTTTTGCTACTTGTCTGGGTCTGGTGTACATATATGGCCGTCACCTATA CTTCTGGGGATATTCAGAAGCTGCTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001204368
Insert Size	234 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001204368.1
RefSeq Size	746 bp
RefSeq ORF	234 bp
Locus ID	4258
UniProt ID	Q99735
Protein Families	Druggable Genome, Transmembrane
Protein Pathways	Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
MW	8.4 kDa
Gene Summary	The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (4) lacks an exon in the 3' region, which results in frame-shift, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.