Ribosomal protein S10 (RPS10) (NM_001204091) Human Untagged Clone

CAT#: SC329703

RPS10 (untagged) - Homo sapiens ribosomal protein S10 (RPS10), transcript variant 3



  "NM_001204091" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RPS10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA9; S10
Vector pCMV6-Entry
Sequence Data
>SC329703 representing NM_001204091.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTGATGCCTAAGAAGAACCGGATTGCCATTTATGAACTCCTTTTTAAGGAGGGAGTCATGGTGGCC
AAGAAGGATGTCCACATGCCTAAGCACCCGGAGCTGGCAGACAAGAATGTGCCCAACCTTCATGTCATG
AAGGCCATGCAGTCTCTCAAGTCCCGAGGCTACGTGAAGGAACAGTTTGCCTGGAGACATTTCTACTGG
TACCTTACCAATGAGGGTATCCAGTATCTCCGTGATTACCTTCATCTGCCCCCGGAGATTGTGCCTGCC
ACCCTACGCCGTAGCCGTCCAGAGACTGGCAGGCCTCGGCCTAAAGGTCTGGAGGGTGAGCGACCTGCG
AGACTCACAAGAGGGGAAGCTGACAGAGATACCTACAGACGGAGTGCTGTGCCACCTGGTGCCGACAAG
AAAGCCGAGGCTGGGGCTGGGTCAGCAACCGAATTCCAGTTTAGAGGCGGATTTGGTCGTGGACGTGGT
CAGCCACCTCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204091
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204091.1
RefSeq Size 666 bp
RefSeq ORF 498 bp
Locus ID 6204
UniProt ID P46783
Protein Pathways Ribosome
MW 18.9 kDa
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S10E family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternate splicing results in multiple transcript variants that encode the same protein. Naturally occurring read-through transcription occurs between this locus and the neighboring locus NUDT3 (nudix (nucleoside diphosphate linked moiety X)-type motif 3).[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...