COX16 (NM_001204090) Human Untagged Clone
CAT#: SC329702
COX16 (untagged) - Homo sapiens COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C14orf112; hCOX16; HSPC203 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329702 representing NM_001204090.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTTGCACCCGCGGTGATGCGTGCTTTTCGCAAGAACAAGACTCTCGGCTATGGAGTCCCCATGTTG ATGGATCCTGAGCTTGAAAAAAAACTGAAAGAGAATAAAATATCTTTAGAGTCGGAATATGAGAAAATC AAAGACTCCAAGTTTGATGACTGGAAGAATATTCGAGGACCCAGGCCTTGGGAAGATCCTGACCTCCTC CAAGGAAGAAATCCAGAAAGCCTTAAGACTAAGACAACTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204090 |
Insert Size | 249 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204090.1 |
RefSeq Size | 1652 bp |
RefSeq ORF | 249 bp |
Locus ID | 51241 |
UniProt ID | Q9P0S2 |
Protein Families | Secreted Protein, Transmembrane |
MW | 9.6 kDa |
Gene Summary | Required for the assembly of the mitochondrial respiratory chain complex IV (CIV), also known as cytochrome c oxidase (PubMed:29355485, PubMed:29381136). Promotes the insertion of copper into the active site of cytochrome c oxidase subunit II (MT-CO2/COX2) (PubMed:29355485, PubMed:29381136). Interacts specifically with newly synthesized MT-CO2/COX and its copper center-forming metallochaperones SCO1, SCO2 and COA6 (PubMed:29381136). Probably facilitates MT-CO2/COX2 association with the MITRAC assembly intermediate containing MT-CO1/COX1, thereby participating in merging the MT-CO1/COX1 and MT-CO2/COX2 assembly lines (PubMed:29381136).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231569 | COX16 (Myc-DDK tagged) - Homo sapiens COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), transcript variant 2 |
CNY 3,990.00 |
|
RG231569 | COX16 (tGFP-tagged) - Homo sapiens COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16), transcript variant 2 |
CNY 4,370.00 |