NDUFC2 (NM_001204054) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	B14.5b; CI-B14.5b; HLC-1; NADHDH2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329687 representing NM_001204054. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATCGCACGGCGGAACCCAGAACCCTTACGGTTTCTGCCGGATGAGGCCCGGAGCCTGCCCCCGCCC AAGCTGACCGACCCGCGGCTCCTCTACATCGGCTTCTTGGGCTACTGCTCCGGCCTGATTGATAACCTA ATCCGGCGGAGGCCGATCGCGACGGCTGGTTTGCATCGCCAGCTTCTATATATTACGGCCTTTTTTTTT GCTGGATATTATCTTGTAAAACTTGAAGCTTATGCTAATCTGTATGTTGACACCTTGTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001204054
Insert Size	267 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001204054.1
RefSeq Size	2284 bp
RefSeq ORF	267 bp
Locus ID	4718
UniProt ID	O95298
Protein Families	Transmembrane
Protein Pathways	Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW	10.1 kDa
Gene Summary	Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses alternate splice sites in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.