UBE2H (NM_001202498) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	E2-20K; GID3; UBC8; UBCH; UBCH2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329665 representing NM_001202498. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAATAAAATTTTCCATCCCAACATTGATGAAGCGTCAGGAACTGTGTGTCTAGATGTAATTAATCAA ACTTGGACAGCTCTCTATGATCTTACCAATATATTTGAGTCCTTCCTGCCTCAGTTATTGGCCTATCCT AACCCCATAGATCCTCTCAATGGTGACGCTGCAGCCATGTACCTCCACCGACCAGAAGAATACAAGCAG AAAATTAAAGAGTACATCCAGAAATACGCCACGGAGGAGGCGCTGAAAGAACAGGAAGAGGGTACCGGG GACAGCTCATCGGAGAGCTCTATGTCTGACTTTTCCGAAGATGAGGCCCAGGATATGGAGTTGTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001202498
Insert Size	342 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001202498.1
RefSeq Size	4778 bp
RefSeq ORF	342 bp
Locus ID	7328
UniProt ID	P62256
Protein Pathways	Ubiquitin mediated proteolysis
MW	12.9 kDa
Gene Summary	The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (3) has an alternate splice site in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.