HYAL3 (NM_001200031) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HYAL-3; LUCA-3; LUCA3
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329611 representing NM_001200031. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCTGCCACCTGCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTT GTTGGGCACCGACATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTC CTGTCCCAGGATGACCTTGTGCAGTCCATTGGTGTGAGTGCAGCACTAGGGGCAGCCGGCGTGGTGCTC TGGGGGGACCTGAGCCTCTCCAGCTCTGAGGAGGAGTGCTGGCATCTCCATGACTACCTGGTGGACACC TTGGGCCCCTATGTGATCAATGTGACCAGGGCAGCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCAC GGGCGCTGTGCCCGGCGAGATCCAGGACAGATGGAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTT GGAGATTGGAAGTCCTTCAGCTGCCACTGTTACTGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGG CCTGGGCCTAAAGAAGCAGTATAA
Restriction Sites	SgfI-MluI
ACCN	NM_001200031
Insert Size	507 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001200031.1
RefSeq Size	1179 bp
RefSeq ORF	507 bp
Locus ID	8372
UniProt ID	O43820
Protein Families	Secreted Protein
Protein Pathways	Glycosaminoglycan degradation, Metabolic pathways
MW	18.8 kDa
Gene Summary	This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3), also known as HYAL3-v2, initiates translation at an upstream start codon and uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.