CRABP2 (NM_001199723) Human Untagged Clone
CAT#: SC329550
CRABP2 (untagged) - Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRABP-II; RBP6 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329550 representing NM_001199723.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCCAACTTCTCTGGCAACTGGAAAATCATCCGATCGGAAAACTTCGAGGAATTGCTCAAAGTGCTG GGGGTGAATGTGATGCTGAGGAAGATTGCTGTGGCTGCAGCGTCCAAGCCAGCAGTGGAGATCAAACAG GAGGGAGACACTTTCTACATCAAAACCTCCACCACCGTGCGCACCACAGAGATTAACTTCAAGGTTGGG GAGGAGTTTGAGGAGCAGACTGTGGATGGGAGGCCCTGTAAGAGCCTGGTGAAATGGGAGAGTGAGAAT AAAATGGTCTGTGAGCAGAAGCTCCTGAAGGGAGAGGGCCCCAAGACCTCGTGGACCAGAGAACTGACC AACGATGGGGAACTGATCCTGACCATGACGGCGGATGACGTTGTGTGCACCAGGGTCTACGTCCGAGAG TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199723 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199723.1 |
RefSeq Size | 1075 bp |
RefSeq ORF | 417 bp |
Locus ID | 1382 |
UniProt ID | P29373 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 15.7 kDa |
Gene Summary | This gene encodes a member of the retinoic acid (RA, a form of vitamin A) binding protein family and lipocalin/cytosolic fatty-acid binding protein family. The protein is a cytosol-to-nuclear shuttling protein, which facilitates RA binding to its cognate receptor complex and transfer to the nucleus. It is involved in the retinoid signaling pathway, and is associated with increased circulating low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) has an alternate 5' UTR and encodes the same protein, as compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231783 | CRABP2 (Myc-DDK tagged) - Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2 |
CNY 1,200.00 |
|
RG231783 | CRABP2 (tGFP-tagged) - Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2 |
CNY 4,370.00 |