CRABP2 (NM_001199723) Human Untagged Clone

CAT#: SC329550

CRABP2 (untagged) - Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2



  "NM_001199723" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CRABP2 mouse monoclonal antibody, clone OTI10D6 (formerly 10D6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRABP-II; RBP6
Vector pCMV6-Entry
Sequence Data
>SC329550 representing NM_001199723.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCAACTTCTCTGGCAACTGGAAAATCATCCGATCGGAAAACTTCGAGGAATTGCTCAAAGTGCTG
GGGGTGAATGTGATGCTGAGGAAGATTGCTGTGGCTGCAGCGTCCAAGCCAGCAGTGGAGATCAAACAG
GAGGGAGACACTTTCTACATCAAAACCTCCACCACCGTGCGCACCACAGAGATTAACTTCAAGGTTGGG
GAGGAGTTTGAGGAGCAGACTGTGGATGGGAGGCCCTGTAAGAGCCTGGTGAAATGGGAGAGTGAGAAT
AAAATGGTCTGTGAGCAGAAGCTCCTGAAGGGAGAGGGCCCCAAGACCTCGTGGACCAGAGAACTGACC
AACGATGGGGAACTGATCCTGACCATGACGGCGGATGACGTTGTGTGCACCAGGGTCTACGTCCGAGAG
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001199723
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199723.1
RefSeq Size 1075 bp
RefSeq ORF 417 bp
Locus ID 1382
UniProt ID P29373
Protein Families Druggable Genome, Transcription Factors
MW 15.7 kDa
Gene Summary This gene encodes a member of the retinoic acid (RA, a form of vitamin A) binding protein family and lipocalin/cytosolic fatty-acid binding protein family. The protein is a cytosol-to-nuclear shuttling protein, which facilitates RA binding to its cognate receptor complex and transfer to the nucleus. It is involved in the retinoid signaling pathway, and is associated with increased circulating low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) has an alternate 5' UTR and encodes the same protein, as compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...