AK2 (NM_001199199) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ADK2
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329496 representing NM_001199199. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTGCTGGGGCCT CCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGTGTCTGCCATTTAGCTACT GGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTAGGAAAAAAGCTGAAGGCAACTATGGAT GCTGGGAAACTGGTGAGTGATGAAATGGTAGTGGAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGC AAAAATGGTTTTCTTCTGGATGGCTTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATG GAGAAGAGGAAAGAGAAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATTCACCCC AAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAAGAGCCCATGAAAGATGACATCACCGGG GAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACT CAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACC CCCGATGTCGTGTTCGCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATCCTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001199199
Insert Size	675 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001199199.1
RefSeq Size	3647 bp
RefSeq ORF	675 bp
Locus ID	204
UniProt ID	P54819
Protein Families	Druggable Genome
Protein Pathways	Metabolic pathways, Purine metabolism
MW	24.6 kDa
Gene Summary	Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010] Transcript Variant: This variant (3) uses an alternate in-frame splice junction and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.