GNG10 (NM_001198664) Human Untagged Clone
CAT#: SC329468
GNG10 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
Sequence Data |
>SC329468 representing NM_001198664.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCAGCGCTTGGTAGAGCAGCTCAAGTTGGAGGCTGGCGTG GAGAGGATCAAGGTCTCTCAGGCAGCTGCAGAGCTTCAACAGTACTGTATGCAGAATGCCTGCAAGGAT GCCCTGCTGGTGGGTGTTCCAGCTGGAAGTAACCCCTTCCGGGAGCCTAGATCCTGTGCTTTACTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001198664 |
Insert Size | 207 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001198664.1 |
RefSeq Size | 1266 bp |
RefSeq ORF | 207 bp |
Locus ID | 2790 |
UniProt ID | P50151 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
MW | 7.2 kDa |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. Interacts with beta-1 and beta-2, but not with beta-3.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231530 | GNG10 (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 2 |
CNY 1,200.00 |
|
RG231530 | GNG10 (tGFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 2 |
CNY 4,370.00 |