IFRD1 (NM_001197080) Human Untagged Clone

CAT#: SC329460

IFRD1 (untagged) - Homo sapiens interferon-related developmental regulator 1 (IFRD1), transcript variant 4



  "NM_001197080" in other vectors (2)

CNY 3,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-IFRD1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PC4; TIS7
Vector pCMV6-Entry
Sequence Data
>SC329460 representing NM_001197080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCCATTGCAGTGGTTATAGCGATCCTTCCAGTTTTGCTGAAGATGGACCAGAAGTCCTTGATGAG
GAAGGAACTCAAGAAGACCTAGAGTACAAGTTGAAGGGATTAATTGACCTAACCCTGGATAAGAGTGCG
AAGACAAGGCAAGCAGCTCTTGAAGGTATTAAAAATGCACTGGCTTCAAAAATGCTGTATGAATTTATT
CTGGAAAGGAGAATGACTTTAACTGATAGCATTGAACGCTGCCTGAAAAAAGGTAAGAGTGATGAGCAA
CGTGCAGCTGCAGCGTTAGCATCTGTTCTTTGTATTCAGCTGGGCCCTGGAATTGAAAGTGAAGAGATT
TTGAAAACTCTTGGACCAATCCTAAAGAAAATCATTTGTGATGGGTCAGCTAGTATGCAGGCTAGGCAA
ACTTGTGCAACTTGCTTTGGTGTTTGCTGTTTTATTGCCACAGATGACATTACTGAACTATACTCAACT
CTGGAATGTTTGGAAAATATCTTCACTAAATCCTATCTCAAAGAGAAAGACACTACTGTTATTTGCAGC
ACTCCTAATACAGTGCTTCATATCAGCTCTCTTCTTGCATGGACACTACTGCTGACCATATGCCCAATC
AATGAAGTGAAGAAAAAGCTTGAGATGCATTTCCATAAGCTTCCAAGCCTCCTCTCTTGTGATGATGTA
AACATGAGAATAGCTGCTGGTGAATCTTTGGCACTTCTCTTTGAATTGGCCAGAGGAATAGAGAGTGAC
TTTTTTTATGAAGACATGGAGTCCTTGACGCAGATGCTTAGGGCCTTGGCAACAGATGGAAATAAACAC
CGGGCCAAAGTGGACAAGAGAAAGCAGCGGTCAGTTTTCAGAGATGTCCTGAGGGCAGTGGAGGAACGG
GATTTTCCAACAGAAACCATTAAATTTGGTCCTGAACGCATGTATATTGATTGCTGGGTAAAAAAACAC
ACCTATGACACCTTTAAGGAGGTTCTTGGATCAGGGATGCAGTACCACTTGCAGTCAAATGAATTCCTT
CGAAATGTATTTGAACTTGGACCCCCAGTGATGCTTGATGCTGCAACGCTTAAAACGATGAAGATTTCT
CGTTTCGAAAGGCATTTATATAACTCTGCAGCCTTCAAAGCTCGAACCAAAGCTAGAAGCAAATGTCGA
GATAAGAGAGCAGATGTTGGAGAATTCTTCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001197080
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001197080.1
RefSeq Size 3239 bp
RefSeq ORF 1206 bp
Locus ID 3475
UniProt ID O00458
MW 45.3 kDa
Gene Summary This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Both variant 3 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...