CYBC1 (NM_001193655) Human Untagged Clone
CAT#: SC329440
C17orf62 (untagged) - Homo sapiens chromosome 17 open reading frame 62 (C17orf62), transcript variant 6
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C17orf62; CGD5; Eros |
Vector | pCMV6-Entry |
Sequence Data |
>SC329440 representing NM_001193655.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTACCTGCAGGTGGAGACCCGCACCAGCTCCCGCCTCCATCTGAAGAGGGCTCCAGGCATCCGGTCC TGGTCCCTGCTGGTTGGAATCTTGTCGATTGGCCTGGCTGCTGCCTACTACAGCGGAGATAGCCTGGGC TGGAAGCTCTTCTACGTCACAGGCTGCCTGTTTGTGGCTGTGCAGAACTTGGAGGACTGGGAGGAAGCC ATCTTCGACAAGAGCACAGGGAAGGTTGTTTTGAAGACGTTCAGCCTCTACAAGAAGCTGCTGACTCTT TTCAGAGCTGGCCACGACCAGGTGGTGGTCCTGCTCCATGATGTCCGTGATGTGAGCGTGGAGGAGGAG AAGGTCCGGTACTTCGGGAAAGGCTACATGGTGGTGCTCCGGCTTGCGACGGGCTTCTCCCACCCCCTC ACGCAGAGTGCAGTCATGGGCCACCGCAGTGATGTGGAAGCCATCGCCAAGCTCATCACCAGCTTCCTG GAGCTGCACTGCCTTGAGAGCCCCACAGAGCTGTCTCAGAGCAGCGACAGTGAGGCCGGTGACCCTGCA AGCCAGAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001193655 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001193655.1 |
RefSeq Size | 2331 bp |
RefSeq ORF | 564 bp |
Locus ID | 79415 |
UniProt ID | Q9BQA9 |
Protein Families | Transmembrane |
MW | 20.8 kDa |
Gene Summary | Necessary for a stable expression of the CYBA and CYBB subunits of the cytochrome b-245 hetrodimer. Controls the phagocyte respiratory burst and is essential for innate immunity.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) contains a different segment for its 5' UTR, compared to variant 1. Variants 1, 4, 5, 6, and 7 all encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232025 | C17orf62 (Myc-DDK tagged) - Homo sapiens chromosome 17 open reading frame 62 (C17orf62), transcript variant 6 |
CNY 2,400.00 |
|
RG232025 | C17orf62 (tGFP-tagged) - Homo sapiens chromosome 17 open reading frame 62 (C17orf62), transcript variant 6 |
CNY 4,370.00 |