LIMS1 (NM_001193488) Human Untagged Clone

CAT#: SC329435

LIMS1 (untagged) - Homo sapiens LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 3



  "NM_001193488" in other vectors (2)

CNY 3,140.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-LIMS1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PINCH; PINCH-1; PINCH1
Vector pCMV6-Entry
Sequence Data
>SC329435 representing NM_001193488.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCAACGCCCTGGCCAGCGCCACTTGCGAGCGCTGCAAGGGCGGCTTTGCGCCCGCTGAGAAGATC
GTGAACAGTAATGGGGAGCTGTACCATGAGCAGTGTTTCGTGTGCGCTCAGTGCTTCCAGCAGTTCCCA
GAAGGACTCTTCTATGAGTTTGAAGGAAGAAAGTACTGTGAACATGACTTTCAGATGCTCTTTGCCCCT
TGCTGTCATCAGTGTGGTGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCG
GAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTTCTGGCAGATATCGGGTTTGTCAAGAATGCTGGGAGA
CACCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGAGGCCTTGGGAAATACATCTGCCAGAAATGC
CATGCTATCATCGATGAGCAGCCTCTGATATTCAAGAACGACCCCTACCATCCAGACCATTTCAACTGC
GCCAACTGCGGGAAGGAGCTGACTGCCGATGCACGGGAGCTGAAAGGGGAGCTATACTGCCTCCCATGC
CATGATAAAATGGGGGTCCCCATCTGTGGTGCTTGCCGACGGCCCATCGAAGGGCGCGTGGTGAACGCT
ATGGGCAAGCAGTGGCATGTGGAGCATTTTGTTTGTGCCAAGTGTGAGAAACCCTTTCTTGGACATCGC
CATTATGAGAGGAAAGGCCTGGCATATTGTGAAACTCACTATAACCAGCTATTTGGTGATGTTTGCTTC
CACTGCAATCGTGTTATAGAAGGTGATGTGGTCTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGCTTT
GCCTGTTCTACCTGCAACACTAAATTAACACTCAAGAATAAGTTTGTGGAGTTTGACATGAAGCCAGTC
TGTAAGAAGTGCTATGAGAAATTTCCATTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTA
GGAAGGAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001193488
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001193488.1
RefSeq Size 4407 bp
RefSeq ORF 978 bp
Locus ID 3987
UniProt ID P48059
Protein Families Druggable Genome
MW 37.3 kDa
Gene Summary The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...