PFD6 (PFDN6) (NM_001185181) Human Untagged Clone

CAT#: SC329414

PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 1



  "NM_001185181" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PFDN6 (PFD6) mouse monoclonal antibody, clone OTI4E10 (formerly 4E10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H2-KE2; HKE2; KE-2; PFD6
Vector pCMV6-Entry
Sequence Data
>SC329414 representing NM_001185181.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTA
AGTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAA
CTGGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTG
GGGGAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCC
CAGCTTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTC
CAGCGGGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001185181
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001185181.2
RefSeq Size 705 bp
RefSeq ORF 390 bp
Locus ID 10471
UniProt ID O15212
Protein Families Stem cell - Pluripotency
MW 14.6 kDa
Gene Summary PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]).[supplied by OMIM, Jul 2010]
Transcript Variant: This variant (1) represents the longest transcript. All variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...