Claudin 12 (CLDN12) (NM_001185072) Human Untagged Clone

CAT#: SC329412

CLDN12 (untagged) - Homo sapiens claudin 12 (CLDN12), transcript variant 1



  "NM_001185072" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CLDN12 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC329412 representing NM_001185072.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCTGTCGGGATGTCCACGCAGCCACAGTCCTTTCCTTCCTGTGTGGAATCGCCTCAGTAGCAGGC
CTCTTTGCAGGGACTCTGCTTCCCAACTGGAGAAAATTACGATTGATCACATTCAACAGAAACGAGAAG
AACCTGACTGTTTACACAGGCCTGTGGGTGAAATGTGCCCGGTATGACGGGAGCAGTGACTGCCTGATG
TACGACACTACTTGGTACTCATCAGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTACCCCTC
AGCATGCTGATCGCCATGGGTGCCCTGCTGCTCTGCCTGATTGGAATGTGCAACACTGCCTTCAGGTCC
TCGGTGCCCAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGTTGCCACCTGGTGGCTGGGCTG
CTATTTTTCCTGGCAGGTACTGTGAGCCTCTCCCCATCTATCTGGGTCATCTTTTATAACATCCATCTG
AACAAGAAGTTTGAGCCAGTCTTTTCATTTGACTATGCAGTGTATGTCACTATTGCTAGTGCTGGGGGC
CTGTTTATGACTTCCCTTATACTATTTATTTGGTATTGTACATGCAAATCTTTGCCTTCTCCTTTCTGG
CAACCATTGTACTCCCATCCACCCAGTATGCATACTTACTCACAGCCCTATTCAGCACGCTCTCGCCTC
TCTGCCATTGAAATTGACATTCCAGTAGTTTCACACACCACTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001185072
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001185072.2
RefSeq Size 3684 bp
RefSeq ORF 735 bp
Locus ID 9069
UniProt ID P56749
Protein Families Transmembrane
MW 27.1 kDa
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed in the inner ear and bladder epithelium, and it is over-expressed in colorectal carcinomas. This protein and claudin 2 are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found.[provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) is the longest transcript. Variants 1-3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...