FOXP2 (NM_001172767) Human Untagged Clone

CAT#: SC328754

FOXP2 (untagged)-Human forkhead box P2 (FOXP2) transcript variant 6



  "NM_001172767" in other vectors (2)

CNY 7,320.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-FOXP2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAGH44; SPCH1; TNRC10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172767, the custom clone sequence may differ by one or more nucleotides
ATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATG
AGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACC
AGCTCTGAAGTAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCA
GCAAGACAACTTCTTTTACAGCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGAT
AAACAGAGACCACTGCAGGAATTGCTTCCAGAAACAAAATTATGTATCTGTGGCCACTCT
TCTGGTGATGGGCATCCTCACAACACATTTGCAGTGCCTGTGTCAGTGGCCATGATGACT
CCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCTCCT
CAGCAGCTACAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTA
CAAGAGTTTTACAAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAG
CAACAGCAGCAGCAGCAACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAACAG
CAGCAACAACAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAG
CAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAATTGGCAGCCCAGCAGCTT
GTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCAGCAGCATCTGCTCAGC
CTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTCCAATCG
CTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGA
GTTCACAGTATGGAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAAT
TCCTCCTCGACTACCTCCTCCAACACTTCCAAAGCATCACCACCAATAACTCATCATTCC
ATAGTGAATGGACAGTCTTCAGTTCTAAGTGCAAGACGAGACAGCTCGTCACATGAGGAG
ACTGGGGCCTCTCACACTCTCTATGGCCATGGAGTTTGCAAATGGCCAGGCTGTGAAAGC
ATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGAACACGCATTGGATGAC
CGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTGGTGCAACAGTTAGAAATACAGCTT
TCTAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACATGCGACCCTCAGAG
CCCAAACCATCTCCCAAACCTGTAAGTGCATATTGCTTTATAAACAGTAAATAG
Restriction Sites Please inquire     
ACCN NM_001172767
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172767.1, NP_001166238.1
RefSeq Size 1489 bp
RefSeq ORF 1374 bp
Locus ID 93986
UniProt ID O15409
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Transcript Variant: This variant (6) differs in the 5' UTR, the 3' coding region and the 3' UTR, compared to variant 2. The resulting isoform (VI) has a distinct C-terminus and is shorter than isoform II.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...