MPP1 (NM_001166462) Human Untagged Clone

CAT#: SC328722

MPP1 (untagged)-Human membrane protein palmitoylated 1 55kDa (MPP1) transcript variant 4



  "NM_001166462" in other vectors (4)

CNY 7,030.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MPP1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AAG12; DXS552E; EMP55; MRG1; PEMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328722 representing NM_001166462.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTCCTGGGCTGTATCGCATCCATTGAATACTGTGACCGAGGACATGTACACCAACGGGTCTCCT
GCCCCAGGTAGCCCTGCCCAGGTCAAGGGACAGGAGGTGCGGAAAGTGCGACTCATACAGTTTGAGAAG
GTCACAGAAGAGCCCATGGGAATCACGCTGAAGCTGAATGAAAAACAGTCCTGTACGGTGGCCAGAATT
CTTCATGGTGGCATGATCCATAGACAAGGCTCCCTTCACGTGGGGGATGAGATCCTAGAAATCAATGGC
ACAAATGTGACAAATCATTCAGTGGATCAGCTGCAGAAGGCGATGAAAGAAACCAAAGGAATGATCTCA
TTAAAAGTAATTCCCAACCAGCAAAGCCGTCTTCCTGCACTACAGATGTTCATGAGAGCGCAGTTTGAC
TATGATCCCAAAAAGGACAATCTGATCCCTTGCAAGGAGGCGGGACTGAAGTTTGCTACTGGGGACATT
ATCCAGATTATCAACAAGGATGACAGCAATTGGTGGCAGGGACGGGTGGAAGGCTCCTCCAAGGAGTCA
GCAGGATTGATCCCTTCCCCTGAGCTGCAGGAATGGCGAGTGGCAAGTATGGCTCAGTCAGCTCCTAGC
GAAGCCCCGAGCTGCAGTCCCTTTGGGAAGAAGAAGAAGTACAAAGACAAATATCTGGCCAAGCACAGC
TCGATTTTTGATCAGTTGGATGTTGTTTCCTACGAGGAAGTCGTTCGGCTCCCTGCATTCAAGAGGAAG
ACCCTGGTGCTGATCGGAGCCAGTGGGGTGGGTCGCAGCCACATTAAGAATGCCCTGCTCAGCCAGAAT
CCGGAGAAGTTTGTGTACCCTGTCCCATATACAACACGGCCGCCAAGGAAGAGTGAGGAAGATGGGAAG
GAGTACCACTTTATCTCAACGGAGGAGATGACGAGGAACATCTCTGCCAATGAGTTCTTGGAGTTTGGC
AGCTACCAAGGCAACATGTTTGGCACCAAATTTGAAACAGTGCACCAGATCCATAAGCAGAACAAGATT
GCCATCCTTGACATTGAGCCCCAGACCCTGAAAATTGTTCGGACAGCAGAACTTTCGCCTTTCATTGTG
TTCATTGCACCTACTGACCAGGGCACTCAGACAGAAGCCCTGCAGCAGCTGCAGAAGGACTCTGAGGCC
ATCCGCAGCCAGTACGCTCACTACTTTGACCTCTCACTGGTCAATAATGGTGTTGATGAAACCCTTAAG
AAATTACAAGAAGCCTTCGACCAAGCGTGCAGTTCTCCACAGTGGGTGCCTGTCTCCTGGGTTTACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166462
Insert Size 1311 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166462.1
RefSeq Size 2216 bp
RefSeq ORF 1311 bp
Locus ID 4354
UniProt ID Q00013
Protein Families Druggable Genome
MW 49.1 kDa
Gene Summary This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) contains an alternate exon in the 5' coding region that results in a distinct 5' UTR and translation initiation at an alternate start codon, compared to variant 1. The encoded protein (isoform 4) has a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...