Repulsive Guidance Molecule A (RGMA) (NM_001166289) Human Untagged Clone

CAT#: SC328716

RGMA (untagged)-Human RGM domain family member A (RGMA) transcript variant 6



  "NM_001166289" in other vectors (4)

CNY 7,220.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (4)
RGMA mouse monoclonal antibody,clone OTI4G8
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RGM
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001166289, the custom clone sequence may differ by one or more nucleotides
ATGGGTATGGGGAGAGGGGCAGGACGTTCAGCCCTGGGATTCTGGCCGACCCTCGCCTTC
CTTCTCTGCAGCTTCCCCGCAGCCACCTCCCCGTGCAAGATCCTCAAGTGCAACTCTGAG
TTCTGGAGCGCCACGTCGGGCAGCCACGCCCCAGCCTCAGACGACACCCCCGAGTTCTGT
GCAGCCTTGCGCAGCTACGCCCTGTGCACGCGGCGGACGGCCCGCACCTGCCGGGGTGAC
CTGGCCTACCACTCGGCCGTCCATGGCATAGAGGACCTCATGAGCCAGCACAACTGCTCC
AAGGATGGCCCCACCTCGCAGCCACGCCTGCGCACGCTCCCACCGGCCGGAGACAGCCAG
GAGCGCTCGGACAGCCCCGAGATCTGCCATTACGAGAAGAGCTTTCACAAGCACTCGGCC
ACCCCCAACTACACGCACTGTGGCCTCTTCGGGGACCCACACCTCAGGACTTTCACCGAC
CGCTTCCAGACCTGCAAGGTGCAGGGCGCCTGGCCGCTCATCGACAATAATTACCTGAAC
GTGCAGGTCACCAACACGCCTGTGCTGCCCGGCTCAGCGGCCACTGCCACCAGCAAGCTC
ACCATCATCTTCAAGAACTTCCAGGAGTGTGTGGACCAGAAGGTGTACCAGGCTGAGATG
GACGAGCTCCCGGCCGCCTTCGTGGATGGCTCTAAGAACGGTGGGGACAAGCACGGGGCC
AACAGCCTGAAGATCACTGAGAAGGTGTCAGGCCAGCACGTGGAGATCCAGGCCAAGTAC
ATCGGCACCACCATCGTGGTGCGCCAGGTGGGCCGCTACCTGACCTTTGCCGTCCGCATG
CCAGAGGAAGTGGTCAATGCTGTGGAGGACTGGGACAGCCAGGGTCTCTACCTCTGCCTG
CGGGGCTGCCCCCTCAACCAGCAGATCGACTTCCAGGCCTTCCACACCAATGCTGAGGGC
ACCGGTGCCCGCAGGCTGGCAGCCGCCAGCCCTGCACCCACAGCCCCCGAGACCTTCCCA
TACGAGACAGCCGTGGCCAAGTGCAAGGAGAAGCTGCCGGTGGAGGACCTGTACTACCAG
GCCTGCGTCTTCGACCTCCTCACCACGGGCGACGTGAACTTCACACTGGCCGCCTACTAC
GCGTTGGAGGATGTCAAGATGCTCCACTCCAACAAAGACAAACTGCACCTGTATGAGAGG
ACTCGGGACCTGCCAGGCAGGGCGGCTGCGGGGCTGCCCCTGGCCCCCCGGCCCCTCCTG
GGCGCCCTCGTCCCGCTCCTGGCCCTGCTCCCTGTGTTCTGCTAG
Restriction Sites Please inquire     
ACCN NM_001166289
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166289.1, NP_001159761.1
RefSeq Size 3078 bp
RefSeq ORF 1305 bp
Locus ID 56963
UniProt ID Q96B86
Gene Summary This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2, 3, 5 and 6 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...