RBMS3 (NM_001177712) Human Untagged Clone

CAT#: SC328713

RBMS3 (untagged)-Human RNA binding motif single stranded interacting protein 3 (RBMS3) transcript variant 4



  "NM_001177712" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RBMS3 mouse monoclonal antibody,clone OTI8A9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001177712, the custom clone sequence may differ by one or more nucleotides
ATGGGCAAACGCCTGGATCAGCCACAAATGTACCCCCAGTACACTTACTACTATCCTCAT
TATCTCCAAACCAAGCAGTCCTATGCACCAGCTCCCCACCCCATGGCTCCTCCCAGCCCC
AGCACAAACAGCAGCAGCAACAACAGCAGCAACAACAGCAGCGGGGAACAGTTGAGTAAA
ACCAACCTGTACATTCGAGGCCTCCCACCAGGCACCACTGACCAGGACCTAATCAAGCTG
TGCCAACCGTATGGAAAAATTGTATCTACAAAGGCAATTCTTGACAAAAACACAAATCAG
TGCAAAGGTTATGGTTTTGTAGATTTTGACAGTCCTGCAGCCGCACAGAAAGCGGTAGCA
TCTCTCAAGGCAAATGGCGTGCAGGCACAGATGGCTAAGCAACAAGAGCAAGACCCAACA
AACCTATACATCTCAAATCTCCCCATTTCTATGGATGAGCAGGAGCTTGAGAATATGCTG
AAACCCTTTGGACATGTCATTTCCACAAGAATACTAAGAGACGCTAATGGAGTCAGCAGA
GGTGTTGGCTTTGCCAGAATGGAGTCTACTGAAAAATGTGAAGTGGTAATTCAACATTTT
AATGGAAAATATCTGAAAACACCACCAGGCATCCCAGCCCCCAGTGAGCCTTTGCTGTGC
AAATTCGCTGATGGAGGACAAAAGAAGCGACAGAATCAAAGCAAATATACCCAGAATGGG
AGGCCTTGGCCCAGGGAAGGAGAGGTACTCAGAGGCAGGACTGTCCCTAGGCAAAATCGT
GAAGCTGGCATGGCTTTGACCTATGACCCCACAGCTGCCATACAGAATGGATTTTATTCT
TCACCGTACAGTATTGCAACCAACCGCATGATTCCACAGACATCTATCACGCCATTCATT
GCTGCTTCCCCTGTCTCCACATACCAGGTCCAGAGTACTTCATGGATGCCTCATCCGCCA
TACGTTATGCAACCAACAGGTGCTGTGATTACACCAACCATGGACCATCCCATGTCAATG
CAGCCAGCCAACATGATGGGCCCACTGACACAGCAGATGAATCACCTTTCGTTGGGCACA
ACAGGAACGTATATGACTGCTGCTGCTCCTATGCAAGGGACCTACATTCCTCAGTACACG
CCTGTGCCTCCGACAGCTGTTTCTATTGAAGGTGTTGTTGCTGATACCTCTCCCCAGACA
GTGGCACCTTCATCCCAGGACACCAGTGGTCAGCAGCAACAGATAGCAGTGGACACATCC
AACGAACATGCACCTGCATATTCTTACCAACAGTCTAAGTAA
Restriction Sites Please inquire     
ACCN NM_001177712
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177712.1, NP_001171183.1
RefSeq Size 1779 bp
RefSeq ORF 1302 bp
Locus ID 27303
UniProt ID Q6XE24
Gene Summary This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (4) differs in the 3' UTR and has multiple differences in the coding region, compared to variant 1. The encoded isoform (4) is shorter and lacks the last aa, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...