ZFX (NM_001178095) Human Untagged Clone

CAT#: SC328710

ZFX (untagged)-Human zinc finger protein X-linked (ZFX) transcript variant 5



  "NM_001178095" in other vectors (4)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ZFX Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZNF926
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328710 representing NM_001178095.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATGAAGATGGGCTTGAATTACAACAAGAGCCAAACTCATTTTTTGATGCAACAGGAGCTGATGGT
ACACACATGGATGGTGATCAAATTGTTGTGGAAGTACAAGAAACTGTTTTTGTTTCAGATGTTGTGGAT
TCAGACATAACTGTGCATAACTTTGTTCCTGATGACCCAGATTCAGTTGTAATCCAAGATGTTATTGAG
GACGTTGTTATAGAAGATGTTCAGTGCCCAGATATCATGGAAGAAGCAGATGTGTCTGAAACGGTCATC
ATTCCTGAGCAAGTGCTGGACTCAGATGTAACTGAAGAAGTTTCTTTAGCACATTGCACAGTCCCAGAT
GATGTTTTAGCTTCTGACATTACTTCAGCCTCAATGTCTATGCCAGAACACGTCTTGACGGGTGATTCT
ATACATGTGTCTGACGTTGGACATGTTGGACATGTTGGACATGTTGAACATGTGGTTCATGATAGTGTA
GTGGAAGCAGAAATTGTCACTGATCCTCTGACTACCGACGTAGTTTCAGAAGAAGTATTGGTAGCAGAC
TGTGCCTCTGAAGCAGTCATAGATGCCAATGGGATCCCTGTGGACCAGCAGGATGATGACAAAGGCAAC
TGTGAGGACTACCTTATGATTTCCTTGGATGATGCTGGCAAAATAGAACACGATGGTTCTTCTGGAATG
ACCATGGACACAGAGTCGGAAATTGATCCTTGTAAAGTGGATGGCACTTGCCCTGAGGTCATCAAGGTG
TACATTTTTAAAGCTGACCCTGGAGAAGATGACTTAGGTGGAACTGTAGACATTGTGGAGAGTGAGCCT
GAGAATGATCATGGAGTTGAACTGCTTGATCAGAACAGCAGTATTCGTGTTCCCAGGGAAAAGATGGTT
TATATGACTGTCAATGACTCTCAGCCAGAAGATGAAGATTTAAATGTTGCTGAAATCGCTGACGAAGTT
TATATGGAAGTGATCGTAGGAGAGGAGGATGCTGCAGCAGCAGCGGCAGCCGCCGCCGTGCACGAGCAG
CAAATGGATGACAATGAAATCAAAACCTTCATGCCGATTGCATGGGCAGCAGCTTATGGTAATAATTCT
GATGGAATTGAAAACCGGAATGGCACTGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGC
AGACTGGCTAAACAAAAACCAAAGAAAAGGAGAAGACCTGATTCCAGGCAGTACCAAACAGGTGAGGGC
GCACGAGTTCCATGGCGCAGCGTGCTCTGCGAGCTCTCAGAGGAAACTCTACAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001178095
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178095.1
RefSeq Size 7534 bp
RefSeq ORF 1299 bp
Locus ID 7543
Protein Families Transcription Factors
MW 46.8 kDa
Gene Summary This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010]
Transcript Variant: This variant (5) lacks two exons in the 5' UTR and has an additional segment in the 3' CDS, as compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...